ID: 1014701936

View in Genome Browser
Species Human (GRCh38)
Location 6:124699621-124699643
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1120
Summary {0: 2, 1: 3, 2: 64, 3: 221, 4: 830}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014701936 Original CRISPR CTGGAGCAGCAGCAAGAGAG TGG (reversed) Intronic
900096311 1:941523-941545 CTGGAGGAGAAGCCAGAGAAGGG + Intronic
900337630 1:2172447-2172469 CTGGCCCAGCAGCCAGGGAGAGG + Intronic
900858262 1:5203709-5203731 CAGGAGCAGGAGGAAGAGGGTGG + Intergenic
900902937 1:5528983-5529005 CCAGAGGAGGAGCAAGAGAGAGG - Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901174495 1:7289061-7289083 CCAGAGCAGGAGGAAGAGAGGGG + Intronic
901276657 1:7996820-7996842 TGGGAGCAGGAGCAAGAGATGGG + Intergenic
901461623 1:9395380-9395402 CAGGAGGATCAGAAAGAGAGAGG - Intergenic
901565723 1:10113190-10113212 CGAGAGCAGGAGCAACAGAGAGG + Intronic
901944871 1:12693619-12693641 CCGGAGCAGGAGGAAGAAAGAGG - Intergenic
902181043 1:14688593-14688615 CAAAAGCAGCAGCAAGGGAGGGG + Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903043060 1:20546464-20546486 ATGGAGCAGGAGGAAGAGAGAGG - Intergenic
903348546 1:22703681-22703703 CTTGAGGAGCAGAAAGAGTGTGG - Intergenic
904034255 1:27550603-27550625 CTTGAGCAGCAGCCTGAGCGTGG - Exonic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904278391 1:29399405-29399427 CTGGAGCAAAAGGAAGAGAGAGG - Intergenic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
905492138 1:38352986-38353008 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
906521033 1:46466927-46466949 CAGGAGCAGCCGCGAAAGAGTGG + Intergenic
906585154 1:46969189-46969211 TGGGAACAGGAGCAAGAGAGCGG - Intergenic
906635839 1:47409902-47409924 CTGGAGAAGGAGCAAGAAATTGG + Intergenic
906802243 1:48748492-48748514 CTGGGGCAGAAGCAAAGGAGGGG + Intronic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907485904 1:54777949-54777971 CCAGAGAAGGAGCAAGAGAGAGG - Intergenic
907777891 1:57536757-57536779 CTGCGGCAGCAGAAAGGGAGAGG - Intronic
907900215 1:58734427-58734449 CAAAAGCAGGAGCAAGAGAGAGG + Intergenic
908929814 1:69305008-69305030 CAAGAGCAGGACCAAGAGAGAGG - Intergenic
909332981 1:74437226-74437248 CTGAAGCAGCAGGAAGTGAGAGG - Intronic
909528703 1:76657594-76657616 CAGGAGCAACAGAGAGAGAGGGG - Intergenic
909553393 1:76925082-76925104 CAAGAGCAGAAGCAAGAGTGAGG + Intronic
909724644 1:78819646-78819668 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
909926855 1:81447968-81447990 CCGGAGCAGGAGGAAGAGACAGG - Intronic
910255240 1:85241372-85241394 CAAGAGCAGGAGCAAGAGAGAGG - Intergenic
910401014 1:86838232-86838254 CTAGAGCAGCAGCAAAACAAAGG - Intergenic
910538044 1:88322664-88322686 CAGGAGCAAAAGCAAGAGTGGGG + Intergenic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
911732801 1:101307836-101307858 CTGGAACAGCAGCCAAAGATTGG + Intergenic
912102815 1:106232914-106232936 CAGGAGCAAGAGCAAGAGTGTGG - Intergenic
912260827 1:108110509-108110531 ATGGAGCAGGAGCAAGGGAGGGG + Intergenic
912516796 1:110221472-110221494 CTGGAGCAGGAGCAAGTTTGAGG - Intronic
912566322 1:110590127-110590149 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913426629 1:118738434-118738456 CTGGGACAGCAGCAAGAAACTGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
915295268 1:154916795-154916817 CAAGAGTAGGAGCAAGAGAGAGG + Intergenic
915300815 1:154950640-154950662 CTGCAGCATCAGCAAAGGAGTGG - Intronic
915654676 1:157349475-157349497 CAAGAGCAGGAGCAAGAGAGAGG + Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916179198 1:162069701-162069723 CTGGATCAGCCGCCAGCGAGCGG - Intergenic
916343795 1:163765839-163765861 CTAGAGTAGGAGCAAGAGAGAGG + Intergenic
916827989 1:168462038-168462060 TTGGAGCAGGAGAAAGAGTGAGG + Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
918404963 1:184202950-184202972 CAGGAGCAGGAGCAAGAGAGAGG + Intergenic
918430458 1:184454665-184454687 CAGGAACAGGAGCAAGAGAGAGG - Intronic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919566561 1:199195932-199195954 CACAAGCAGGAGCAAGAGAGAGG - Intergenic
919767912 1:201139212-201139234 GAGGAGGAGCAGCCAGAGAGAGG - Intronic
920055727 1:203189942-203189964 CTGGATCAGGAGCCAGAGGGTGG + Intergenic
920299796 1:204981754-204981776 CTGGAGAGGCTGCCAGAGAGGGG - Intronic
920609005 1:207419218-207419240 CCAGAGCAGGAGCAAGAGAGTGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921353801 1:214265254-214265276 ATGGAGGAGGAGGAAGAGAGTGG - Intergenic
921405315 1:214772631-214772653 CTGGAGCAGAAGGAAGAGCGAGG - Intergenic
921601199 1:217108658-217108680 GTGAAGCAGAAGCAAGAGAGAGG - Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922128687 1:222755377-222755399 CAGGAGCAGGAGGAAGAGAGAGG + Intergenic
922923556 1:229329204-229329226 CTGGAACAGGAGGAAGAGAGGGG - Intronic
922932795 1:229403365-229403387 CTTGAGCAGAAGGAAGAGTGAGG + Intergenic
923135774 1:231117435-231117457 CAAGAGCAGGAGCAAGAGAGGGG - Intergenic
923785638 1:237065878-237065900 CTGGAGCAGGAGGAAGTGTGGGG + Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924125796 1:240849681-240849703 TGAGAGCAGGAGCAAGAGAGAGG - Intronic
924313973 1:242776570-242776592 CAGAAGCAGGAGCAAGAGAAAGG + Intergenic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
924836377 1:247651823-247651845 CAGGAGCAACAGAGAGAGAGCGG - Intergenic
1063193154 10:3717006-3717028 CTGGAGCAGCAGGAAACGTGGGG + Intergenic
1063900407 10:10726975-10726997 CTGGAGTAGGAGGAAGAGAGAGG + Intergenic
1063969816 10:11373788-11373810 CTGGAGGAGCAGCAAGGACGGGG - Intergenic
1063980510 10:11448114-11448136 CTGGAGCAGCTTCCAGCGAGGGG - Intergenic
1065002379 10:21348604-21348626 CAAGAGCAGAAGCAAGAGAGAGG + Intergenic
1065013967 10:21444432-21444454 CCGGAACAGGAGGAAGAGAGCGG - Intergenic
1065435191 10:25698421-25698443 CGGGAGCAGGAGAAAGACAGAGG - Intergenic
1065579248 10:27154920-27154942 CTGGATGAGCAGGAAGCGAGTGG - Intronic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1065661039 10:28004421-28004443 CTGGATCATCAGGAAGAGGGAGG - Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1065852312 10:29801041-29801063 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
1066197398 10:33114464-33114486 CTGCAGCAACAGCCAGAGACTGG + Intergenic
1066213889 10:33267077-33267099 CCGGAGCAGGAGCAAGAGAGAGG - Intronic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1067161405 10:43827905-43827927 CTGGACAAGCAGCAAGAGCTGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067295032 10:44970832-44970854 CGAAAGCAGGAGCAAGAGAGAGG + Intronic
1067546668 10:47196851-47196873 CTGGAGCAGCAGCAACCACGTGG - Intergenic
1067826589 10:49578529-49578551 TCAGAGCAGGAGCAAGAGAGGGG + Intergenic
1068210807 10:53917913-53917935 CCAGAGCAGGAGCAAGAGGGAGG - Intronic
1068224398 10:54087927-54087949 CCTGAGCAGGAGGAAGAGAGAGG - Intronic
1068413938 10:56692252-56692274 CCAGAGCACGAGCAAGAGAGAGG - Intergenic
1068654614 10:59561993-59562015 CAGGAGCAAGAGGAAGAGAGTGG + Intergenic
1068712248 10:60147705-60147727 CCGGTGCAGGAGGAAGAGAGAGG - Intronic
1068762891 10:60732996-60733018 CTGGAGCATCCCCAGGAGAGAGG - Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069684643 10:70309815-70309837 CTGTGGCAGCAGCATGACAGGGG - Intronic
1069787672 10:70998986-70999008 CTAGAGGGGGAGCAAGAGAGAGG - Intergenic
1070413085 10:76162574-76162596 TGGGAGCAGGAGCAAGAGAGAGG + Intronic
1070679768 10:78440351-78440373 CTAGAGCAGGAGGAAGAGAGGGG + Intergenic
1070802539 10:79251976-79251998 CAGGAGCAGCATCAGGACAGGGG + Intronic
1071801040 10:89060617-89060639 CCAGAGCAGGATCAAGAGAGAGG - Intergenic
1072655913 10:97330368-97330390 CTGGATCAGTAGCAAGAGTTGGG + Intergenic
1072727771 10:97825150-97825172 CTGGTGCAGTAGGAAGAGTGCGG + Intergenic
1073101414 10:101008616-101008638 CTGGAGCAGCATCAAGGGGTTGG + Intronic
1073396830 10:103224938-103224960 CTGGAGCAAGAGGAAGAGATCGG + Intergenic
1073950070 10:108797315-108797337 CAAGAGCAGAAGGAAGAGAGAGG + Intergenic
1074127661 10:110542418-110542440 CAGGAGCAGGACCGAGAGAGAGG + Intergenic
1074525790 10:114261972-114261994 CGAGAGCAGGAGCAAGAGAGAGG + Intronic
1074720858 10:116263967-116263989 CTGGAGATCCAGGAAGAGAGAGG + Intronic
1074804070 10:117029678-117029700 CTGGAGCAGGAGCAAGAAGGTGG - Intronic
1075035594 10:119064525-119064547 CTGGAGCAGGAGGAAGACAGAGG - Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075597042 10:123739650-123739672 CTGGGGCAAGAGCAAGAGAGGGG - Intronic
1075628603 10:123985146-123985168 CAAAAGCAGTAGCAAGAGAGAGG + Intergenic
1075761024 10:124856774-124856796 CTGGAGCCTCAGGAAGGGAGGGG - Intergenic
1075815538 10:125261880-125261902 CTTGATCAGCAGCATGAAAGTGG + Intergenic
1076002349 10:126922367-126922389 CAAGAGCAGGAGCAAGAGAGGGG + Intronic
1076012111 10:126997470-126997492 CTAGAGCAGGAGGAAGAGAGAGG + Intronic
1076510402 10:131009957-131009979 CTTGAGCAAGAGCAACAGAGTGG - Intergenic
1076698797 10:132259577-132259599 CTGGAGCAGGTAGAAGAGAGTGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077186315 11:1236902-1236924 CTGCAGAGGCAGCGAGAGAGTGG - Intronic
1077204030 11:1332927-1332949 CTAGAGCAGGAGCAAGAGGGGGG + Intergenic
1077399720 11:2348243-2348265 CAAAAGCAGGAGCAAGAGAGAGG - Intergenic
1077746562 11:4913761-4913783 CTGAAGCAGAAGTGAGAGAGAGG - Intronic
1077918539 11:6626299-6626321 CTGGTGCTGCAGGCAGAGAGTGG - Exonic
1078393231 11:10954768-10954790 GTGGAGCAGAAGAAAGAGAGAGG - Intergenic
1078750345 11:14155444-14155466 CTGGAGCAGGAGGAAGGCAGGGG + Intronic
1078824821 11:14919298-14919320 TGAGAGCAGGAGCAAGAGAGAGG - Intronic
1079282834 11:19103378-19103400 CTGGAGCTGCAGCAAGGTAGAGG - Intergenic
1079416806 11:20245257-20245279 CTGGAAAAGCAGTAAGAAAGAGG - Intergenic
1079603721 11:22341532-22341554 CTGGAGAAGAAGCAAGACACCGG + Exonic
1079827889 11:25221074-25221096 CAAGAGCAGGAGCAAGAGATAGG - Intergenic
1079873027 11:25823242-25823264 CAGGAGCAAGAGCAAGAGAGTGG - Intergenic
1079958718 11:26895767-26895789 CCAGAGCAGGAGAAAGAGAGGGG - Intergenic
1080301840 11:30793105-30793127 CAAAAGCAGGAGCAAGAGAGAGG + Intergenic
1080414651 11:32057982-32058004 TGGGAACAGCAGCAGGAGAGAGG + Intronic
1080572810 11:33571588-33571610 CAGGAGTAGAAGCAAGAAAGAGG + Intronic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1081093163 11:38898150-38898172 TGAGAGCAGGAGCAAGAGAGAGG - Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081643910 11:44777012-44777034 CTGGGGAAGCACCCAGAGAGGGG - Intronic
1081786356 11:45750537-45750559 CTGGGGCAGCAGCATGGCAGAGG + Intergenic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082076426 11:47979614-47979636 CAGGAGAAGCCGCAAGAGAAAGG - Intergenic
1082714705 11:56597918-56597940 AGGGAGCAGCAGCGAGACAGAGG + Intergenic
1082878506 11:58014136-58014158 CTGGAGCAGAAGGGAAAGAGAGG + Intergenic
1083174276 11:60939446-60939468 CTGGTGCAGGAGCAGGGGAGGGG + Intronic
1083266053 11:61547309-61547331 CTGGAGGGGCAGAGAGAGAGGGG + Intronic
1083424539 11:62576245-62576267 CTGGAGGAGGAGGAAGAGTGGGG + Intronic
1083855380 11:65390615-65390637 CCGGGGCAGCAGGAAGAGGGTGG - Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084595698 11:70115696-70115718 GGGGAGGAGCAGCAAGGGAGCGG - Intronic
1084690477 11:70722416-70722438 CTGGAGGAGCAGAAAGGGACAGG - Intronic
1085506125 11:77060715-77060737 CAAGAGGAGAAGCAAGAGAGAGG - Intergenic
1085557497 11:77438208-77438230 CCAGAGCAGGAGCAAGAGAGAGG + Intronic
1085635808 11:78158762-78158784 CTGCAGCAGAGGCAACAGAGAGG - Intergenic
1085740565 11:79074898-79074920 CTGTAGCAACAGCAAGAAACTGG - Intronic
1086229027 11:84546289-84546311 CCAGAGCAGGAGGAAGAGAGAGG - Intronic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1086509909 11:87544834-87544856 CAGGAGCACGAACAAGAGAGTGG + Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087847860 11:102993547-102993569 TTGGAGCAGGAGAGAGAGAGCGG - Intergenic
1087900371 11:103633509-103633531 CTTGAGCATGAGGAAGAGAGAGG - Intergenic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1088938916 11:114434285-114434307 CCAGAGCAGGAGCAAGGGAGTGG + Intronic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089073276 11:115717338-115717360 CTGGAGCAGGAGCAAGATCCGGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089746039 11:120617704-120617726 CCGGAGCAGGAGGAAGAGTGGGG - Intronic
1089758665 11:120706783-120706805 CTGGGACAGCAGCTACAGAGGGG - Intronic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1090486069 11:127113113-127113135 TTGGAGCAGGAGAGAGAGAGAGG + Intergenic
1090634512 11:128682358-128682380 ATGAAACAGGAGCAAGAGAGAGG - Intergenic
1091092462 11:132784773-132784795 CAAGAGCAGGAGCAAGAGAGAGG - Intronic
1091208447 11:133836211-133836233 CCTGGGCAGCAGCAAGTGAGAGG - Intergenic
1091236835 11:134027783-134027805 CTGGCACAGCAGGAAGAGATGGG - Intergenic
1091634353 12:2186005-2186027 CTGGAAAAGGAGCCAGAGAGCGG - Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1092940383 12:13402319-13402341 CTGGAGAAGGTGGAAGAGAGAGG - Intergenic
1093185955 12:16020268-16020290 CTGGAGCAGGAAGAAGAGAGAGG + Intronic
1093906845 12:24703156-24703178 CAAGAGCAGGAGCAAGAGAAGGG - Intergenic
1093933042 12:24973386-24973408 TTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1093990757 12:25587443-25587465 CGAGAGCAGAAGCAAGAGAGAGG + Intronic
1094052958 12:26240528-26240550 GAGGAGCAGGAGAAAGAGAGGGG + Intronic
1094732261 12:33191652-33191674 CAAAAGCAGGAGCAAGAGAGTGG - Intergenic
1095154648 12:38837629-38837651 CTGGAGAAGCAGCAAGGGAGAGG + Intronic
1095980986 12:47974722-47974744 CTGGTGGAGCAGCAAGAGCAAGG - Exonic
1096322682 12:50629201-50629223 CAGGAGCAGCAGGAAGTGAAGGG - Intronic
1096651750 12:53065289-53065311 CTGGGGCAGCAGCCAGTGAAAGG + Exonic
1096864393 12:54553290-54553312 CTGGAGCAGAGAAAAGAGAGTGG - Intronic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1098094984 12:66945545-66945567 CAAAAGCAGAAGCAAGAGAGTGG + Intergenic
1098632482 12:72740883-72740905 CTGCAGTAGCAGTGAGAGAGGGG - Intergenic
1100002549 12:89855043-89855065 TGAGAGCAGGAGCAAGAGAGGGG + Intergenic
1100559033 12:95728922-95728944 CAGGAGCAGCAGCAAGGGTAGGG - Intronic
1100659254 12:96678959-96678981 ATGAAGCAGGACCAAGAGAGAGG - Intronic
1100785195 12:98071234-98071256 CTGGAGCGGGAGGAAGGGAGAGG + Intergenic
1100813532 12:98363520-98363542 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1101068850 12:101051717-101051739 CTGCAGCAGTAGCTAGAAAGTGG + Intronic
1101228049 12:102709480-102709502 CAGGAGCAGGAGCAAAAGAGAGG + Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101577532 12:106011728-106011750 CAGGAGCAGGAGGAAGAGAGAGG - Intergenic
1101667632 12:106833935-106833957 CAAGAGCGGCAGCAAGAAAGAGG - Intronic
1102347867 12:112171075-112171097 CTGGCCCTGCAGGAAGAGAGAGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103532936 12:121614978-121615000 CGGGAGCAGGAGGAAGAGAGGGG + Intergenic
1103896774 12:124278279-124278301 CTCCAGCACCAGCGAGAGAGAGG - Intronic
1104196459 12:126543756-126543778 CTGGTGCAGCAACACCAGAGGGG + Intergenic
1104509729 12:129366404-129366426 CCAGAGCAGGAGCAAGAGAGAGG - Intronic
1105745507 13:23373968-23373990 CTGGAGCAGCGGCAGTGGAGGGG - Intronic
1105899503 13:24743191-24743213 CTGCACCAGGAGCAAGTGAGTGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106358249 13:29005310-29005332 CTGGCCCAGCAGCTGGAGAGGGG + Intronic
1106569940 13:30917697-30917719 ATGGAGCAGGGGGAAGAGAGCGG + Intronic
1106985248 13:35339725-35339747 CAGAAGCAGGAGCAAGAGAGAGG + Intronic
1107262196 13:38506312-38506334 CTGGATCAGGAACAAGAGAGAGG - Intergenic
1107298425 13:38939752-38939774 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107899486 13:44997771-44997793 TGAGAGCACCAGCAAGAGAGTGG - Intronic
1107985917 13:45776082-45776104 CTGGTGCTTCTGCAAGAGAGAGG - Intergenic
1108027711 13:46195824-46195846 CAACAGCAGAAGCAAGAGAGAGG - Intronic
1108479510 13:50854123-50854145 CCGGAGCAGGAGGAAGAGACAGG - Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108809296 13:54201590-54201612 CTGAATCAGGAGCAAAAGAGAGG - Intergenic
1109091396 13:58051158-58051180 ACAGACCAGCAGCAAGAGAGGGG - Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109405079 13:61887194-61887216 CAGAAGCATCACCAAGAGAGTGG + Intergenic
1109856223 13:68131395-68131417 CAGGAGCAGGAGGAAGAGTGGGG + Intergenic
1110137610 13:72087534-72087556 ATGGAGCATCTGCAATAGAGGGG - Intergenic
1110297705 13:73887467-73887489 GGTGAGCAGGAGCAAGAGAGAGG - Intronic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111250895 13:85599926-85599948 CAGGAGCAAGAGAAAGAGAGAGG - Intergenic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1111590457 13:90341161-90341183 CAGGAGCAAGAGCAAGAAAGAGG + Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1111756331 13:92400335-92400357 CTACAGCAACAGCAACAGAGGGG + Intronic
1111933605 13:94536585-94536607 CGGGAGAGGGAGCAAGAGAGAGG - Intergenic
1112252486 13:97795024-97795046 CCAGAGCAGGAGCAAGAGTGGGG + Intergenic
1112354456 13:98662173-98662195 CTGGAGAAGAAGCCAGAGCGTGG + Intergenic
1112568243 13:100569465-100569487 CTGGAGCTGCAGCAACTGGGAGG + Intronic
1113001173 13:105639104-105639126 CAGGAGCAGGAGCAAGAGTAGGG - Intergenic
1113319120 13:109214876-109214898 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1113548004 13:111169429-111169451 CCGGAGCAGGAGCAAGGGAGTGG + Intronic
1114155601 14:20099518-20099540 GTGGAGCAGGAGCAGGGGAGCGG - Intergenic
1114675532 14:24437652-24437674 CCAGAGCAGCAGCCAGGGAGAGG - Exonic
1114773524 14:25455713-25455735 CTGGAGCAGGAGGAAGAAACAGG - Intergenic
1114805866 14:25835975-25835997 CTTGATCATTAGCAAGAGAGAGG + Intergenic
1115082739 14:29477090-29477112 CAGGAGCAAGACCAAGAGAGGGG + Intergenic
1115140940 14:30170131-30170153 TGGGAGCAAGAGCAAGAGAGTGG + Intronic
1115399379 14:32939706-32939728 CGGGAGCAGCAGCGAGGGTGGGG + Intronic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1116536402 14:46036425-46036447 CGAGAGCAGGAGCAAGAGAGGGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116811292 14:49542077-49542099 CCAGAACAGGAGCAAGAGAGGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118097203 14:62550386-62550408 CAAGAGCAGGAGCAACAGAGAGG - Intergenic
1118186561 14:63543191-63543213 CTGCAGCGGCAGCAAGAGAAGGG + Exonic
1118804523 14:69224003-69224025 CAGGAGCAGCACCAAGACGGCGG + Intronic
1118856833 14:69629586-69629608 AAGGAGCATCTGCAAGAGAGTGG - Intronic
1118898787 14:69969449-69969471 CAGGAGCAGGAACAGGAGAGAGG + Intronic
1119033205 14:71208525-71208547 CTAGGGCAGCTGCAAGATAGTGG - Intergenic
1119185219 14:72636490-72636512 GTGGAGGAGCATGAAGAGAGGGG - Intronic
1119681686 14:76597051-76597073 CTGGTGCAGGAGGAAGAGAGAGG + Intergenic
1119907175 14:78316437-78316459 CTGGAGATGCAGGAAGGGAGGGG + Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120016564 14:79480813-79480835 CTGGAGCAAGAGGAAGAGAGAGG - Intronic
1120071651 14:80110086-80110108 CTAGATCAGCAGCAACAGAACGG + Intergenic
1120120220 14:80670010-80670032 CAAAAGCAGGAGCAAGAGAGAGG + Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120601545 14:86516242-86516264 CTAGAGCAGGAGGAAGAGAGAGG - Intergenic
1120707547 14:87760465-87760487 CCAGGGCAGGAGCAAGAGAGAGG + Intergenic
1120791750 14:88590393-88590415 CAGGAGCAGCAGCAAGCACGGGG - Intronic
1120930117 14:89839781-89839803 CTGGAGCAGGGGGAAGAGAGAGG + Intronic
1121154413 14:91669374-91669396 CTGAAGGAGCAGCCAGAGGGTGG + Intronic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121788151 14:96678365-96678387 CTGGAGCAGAAAGAAGAGAGAGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122562972 14:102630238-102630260 CCAGAGAAGCAGCAAGAGAGAGG - Intronic
1122668820 14:103354320-103354342 CAGGAGCGGGAGCAGGAGAGTGG - Intergenic
1122924538 14:104893509-104893531 CTGCACCAGCTGCAAGAGGGAGG - Exonic
1123213734 14:106786387-106786409 CAGGAGCAGGAGGAAGAGAGAGG + Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123811228 15:23928435-23928457 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
1123962596 15:25421211-25421233 CGAGAGCAGGAGCAAGAGAGAGG - Intronic
1124368075 15:29088064-29088086 CCGGGGCAGGAGCCAGAGAGGGG - Intronic
1124626763 15:31312201-31312223 CTGCAGCATCTGCAAGAGAAAGG + Intergenic
1124663031 15:31566773-31566795 CTGGAGCAAGAGAGAGAGAGTGG - Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1124783748 15:32659759-32659781 CTGGAGCAGCAGGAATGGATGGG + Intronic
1125081911 15:35684636-35684658 CAAAAGCAGGAGCAAGAGAGGGG + Intergenic
1125309813 15:38366514-38366536 CTGGTGCAGCTACAAGATAGAGG + Intergenic
1125338536 15:38652060-38652082 TTGGAGAGGCAGGAAGAGAGGGG - Intergenic
1126176991 15:45745044-45745066 CAGGAGAGACAGCAAGAGAGGGG - Intergenic
1126336772 15:47593807-47593829 CTGGAGTGGAAGCAAGAAAGAGG + Intronic
1126911617 15:53422879-53422901 CCTGAGCAACAGGAAGAGAGAGG - Intergenic
1126929379 15:53631238-53631260 CTGGAGAAGGAGCGAGGGAGGGG - Intronic
1126944016 15:53797840-53797862 CTTGAGGAGAAGAAAGAGAGGGG + Intergenic
1127357772 15:58217363-58217385 GTGGAGCAGGAGAGAGAGAGAGG + Intronic
1127518948 15:59724123-59724145 CCAGAGCAGAAGCAAGGGAGAGG + Intergenic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128400148 15:67270629-67270651 TGAGAGAAGCAGCAAGAGAGAGG - Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128645419 15:69375233-69375255 GTGCAGAGGCAGCAAGAGAGTGG - Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128979370 15:72175367-72175389 AAGGAGCATCAGCAGGAGAGTGG - Intronic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1130151685 15:81316072-81316094 CAGGAGCCGGAGCAAGAGCGGGG - Intronic
1130923891 15:88370977-88370999 CTGGAGCAGGAGGAAGTGAGAGG - Intergenic
1131257887 15:90873537-90873559 CTGTTGTGGCAGCAAGAGAGAGG + Intronic
1131261525 15:90890398-90890420 CAGGAGCAGGAGCGAGAGGGGGG + Exonic
1131404702 15:92154759-92154781 CTGGAGTAGAAGCAGGAGTGTGG + Intronic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1131548479 15:93335676-93335698 TTGTAGCTGCAGTAAGAGAGAGG - Intergenic
1132028153 15:98420204-98420226 CGAGAGCAGGAGCAAGAGAGAGG - Intergenic
1132187889 15:99819067-99819089 CTGGATCAGCAACAGGGGAGAGG + Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132672572 16:1107812-1107834 CTGGTCCACCAGCCAGAGAGTGG + Intergenic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133111478 16:3550489-3550511 CTGGAGAACCTGCAAGAGAAGGG + Exonic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133298135 16:4765626-4765648 CGCGAGCAGCAGCCGGAGAGCGG - Exonic
1133458619 16:5966410-5966432 CCGGAGCAGGAGCAAGTGTGAGG + Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1133929205 16:10218479-10218501 CTGCAGCTGCAGCAAGATCGGGG + Intergenic
1134018611 16:10906605-10906627 GAGGAGCAGCAGCAAGAGCCTGG + Exonic
1134229306 16:12416724-12416746 CAAGAGAAGGAGCAAGAGAGAGG + Intronic
1134628720 16:15741509-15741531 CTGGAGGAGGAGGAAGACAGGGG - Exonic
1134852737 16:17494695-17494717 CTGGAGAAGCACTAACAGAGGGG + Intergenic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135590742 16:23703458-23703480 CTAGAGCAGAAACTAGAGAGAGG - Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136099434 16:27982756-27982778 TGAGAGCAGGAGCAAGAGAGAGG + Intronic
1137967987 16:52955724-52955746 CCAGAGCAGGAGAAAGAGAGAGG - Intergenic
1138015014 16:53420283-53420305 CTAGAACAGGAGCAAGAGAGAGG + Intergenic
1138038930 16:53640804-53640826 TTGGGGCAGAAGCTAGAGAGAGG + Intronic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138199987 16:55081517-55081539 CAGGAGCAAGAGCAAGAGAAAGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138689712 16:58755907-58755929 CTGGAGCAGGAGAAAGAATGGGG + Intergenic
1139067514 16:63336617-63336639 TTGGAGTAGGAGGAAGAGAGAGG + Intergenic
1139330961 16:66189555-66189577 ATGGAGCAGCAGCCAGAGCTGGG - Intergenic
1139341303 16:66269905-66269927 CTGAACCAGCAGTTAGAGAGAGG + Intergenic
1139346506 16:66307192-66307214 CTTGAGCATCAGAAACAGAGTGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139557825 16:67723857-67723879 CTGGACTCTCAGCAAGAGAGTGG + Exonic
1139596209 16:67959813-67959835 CTGGAGCAGCTGCTGGGGAGAGG + Intronic
1140634265 16:76892681-76892703 CCAGAGCAGGAACAAGAGAGAGG - Intergenic
1140716964 16:77735371-77735393 CTGGAGCGGGAGACAGAGAGAGG - Intronic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1141043971 16:80698692-80698714 CAGGAGCAGAAGTAAGAGAGAGG - Intronic
1141172511 16:81700336-81700358 GAGGAGCAGCAGCAGGTGAGGGG - Intronic
1141194274 16:81848273-81848295 CTTGGGAAGAAGCAAGAGAGGGG + Intronic
1141873985 16:86809014-86809036 CCGGAGCAGCAGGAGGTGAGCGG - Intergenic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142759555 17:2034811-2034833 ATGGGGCAGCAGCAGGGGAGGGG - Intronic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1143341705 17:6216232-6216254 CTGGAGCTGCCCCAAGAGGGAGG - Intergenic
1143935997 17:10484763-10484785 CTGGAGCAAGAGGAAGAGAGAGG + Intergenic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144699196 17:17325739-17325761 CTGGAGAAGCACACAGAGAGGGG - Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145304693 17:21667040-21667062 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1146596858 17:34176930-34176952 CTGGAACAGGAACAAGAAAGGGG + Intergenic
1146720688 17:35121438-35121460 GTGAAGCAGCATCATGAGAGGGG - Exonic
1147264478 17:39226222-39226244 TTGGGGCCGCAGCAAGATAGCGG + Intergenic
1147716235 17:42510596-42510618 CTGGAGCAGAGGCAGGAGTGGGG + Intronic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1150739323 17:67766737-67766759 CTGGAGAAGCAGCAAAGAAGTGG - Intergenic
1150822834 17:68449622-68449644 CAGGAGCAGGACCAAGAGACGGG - Intronic
1151045536 17:70916165-70916187 CAAGAGCAAGAGCAAGAGAGAGG - Intergenic
1151053565 17:71006589-71006611 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
1151115473 17:71730162-71730184 CAGGAGCAGGACCAAGAGAGAGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151755795 17:76074696-76074718 CAGGAGGAGGAGCAAGAGACAGG - Intronic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152543585 17:80989548-80989570 CCAGAGCAGCAGCAGGACAGGGG + Intergenic
1152584778 17:81184015-81184037 TTGTCGCAGCAGCAAGAGTGAGG + Intergenic
1152899083 17:82929726-82929748 CTGCGGCCGCAGGAAGAGAGTGG - Intronic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1153780241 18:8488645-8488667 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
1154239400 18:12638812-12638834 CTGGAGCAGGAGGAAGAAAGAGG - Intronic
1154327806 18:13404445-13404467 CAGGAGCAGCACCCAGTGAGTGG - Intronic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1155930405 18:31701287-31701309 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
1156220653 18:35048169-35048191 CCAGAGCAGAAGCAAGAGAGAGG + Intronic
1156251164 18:35353562-35353584 CTGGAGCAGGTGCAAGAGAGAGG - Intergenic
1156426108 18:37014646-37014668 CCAGAGCAGGAGGAAGAGAGGGG + Intronic
1156910660 18:42408098-42408120 CCAGAGCAGGAGAAAGAGAGAGG + Intergenic
1157014889 18:43699915-43699937 CCAGAGCAGGAGCAAGAAAGAGG + Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157384261 18:47248157-47248179 CCGAAGCAGCAGCCACAGAGAGG + Intronic
1157673050 18:49546927-49546949 CCAGAGTAGGAGCAAGAGAGAGG + Intergenic
1157685192 18:49637692-49637714 TGAGAGCAGGAGCAAGAGAGAGG - Intergenic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158026615 18:52905544-52905566 CTAGAGCAGCTTCAAGAAAGAGG - Intronic
1158129011 18:54132285-54132307 CCAGAGCAGGAGCAAGAGAGTGG - Intergenic
1158451869 18:57573936-57573958 CAGGAGCAGATGCAAGAGTGGGG - Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159564501 18:70033150-70033172 TGGGAGCAGGAGGAAGAGAGAGG - Intronic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1159695762 18:71554162-71554184 CGGGAGCAGGAGCAAGAGAGAGG - Intergenic
1159966666 18:74601646-74601668 CAAGAGCAGGAGCGAGAGAGTGG + Intronic
1160345621 18:78129459-78129481 CCGGAGCAGGAGCAAGAGTGTGG + Intergenic
1160364066 18:78309285-78309307 CTGGTGCAGCGGGAAGAGGGGGG + Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1161201124 19:3015405-3015427 CTGGAGCAAAAGCTAGAGGGTGG + Intronic
1161234205 19:3189963-3189985 AAGGAGCAGCAGCAAGTCAGAGG - Intronic
1161469131 19:4447677-4447699 CTGGAGCAGGAGGCACAGAGGGG - Intronic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1161803237 19:6427242-6427264 CTGGAGCATCTGCAAGAGAAGGG + Exonic
1162264076 19:9555916-9555938 CCGAAGCAGGAGCAGGAGAGAGG + Intergenic
1162273880 19:9637946-9637968 CTGGATTAGCAACAAGAAAGAGG + Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162799820 19:13104289-13104311 AGGGAGCAGGAGCCAGAGAGGGG + Intergenic
1162958316 19:14112159-14112181 CAGGAGGAGCAGGCAGAGAGAGG + Intronic
1163159219 19:15454776-15454798 CAGGAGCCGCAGGAAGAGGGAGG + Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163863954 19:19756835-19756857 CTGGAGCAGGAGGAAGTGTGGGG + Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164562720 19:29303924-29303946 CTGGAGCAGCCGGGAGAGAGAGG + Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165775749 19:38403438-38403460 CTCGAGCAGCAGCGAGAGGCGGG + Exonic
1165900138 19:39165686-39165708 CAGGAGAAGCAGCCAGTGAGAGG - Intronic
1166894426 19:46015179-46015201 CTGGAGCTGCGGCAGGAGCGCGG + Exonic
1167144339 19:47672920-47672942 CTGAGGCAGAAGCAAGGGAGAGG - Intronic
1167395200 19:49223870-49223892 GTGGAAGAGCAGAAAGAGAGGGG + Intergenic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
925061927 2:898006-898028 CAGGAGCAGGACCAAGAGACGGG - Intergenic
925078650 2:1041644-1041666 GCAGAGCAGGAGCAAGAGAGAGG - Intronic
925151072 2:1615187-1615209 CTGGAGCAGGAGATAGACAGTGG + Intergenic
925246506 2:2388341-2388363 CCAGAACAGGAGCAAGAGAGGGG + Intergenic
925246745 2:2390267-2390289 CAAGAGCAGGAGCAAGAGAGAGG + Intergenic
925606038 2:5661282-5661304 ATAGAGCAGAAGCAAGAGAGTGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926306921 2:11644053-11644075 TGAGAGCAGGAGCAAGAGAGAGG + Intergenic
926610314 2:14940341-14940363 CTGGAGCAGGAGGAAAAGAGAGG - Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927144531 2:20153925-20153947 CCAGAGCAGAAGGAAGAGAGAGG - Intergenic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
928345937 2:30496091-30496113 CTAGAGCAGGAGGAAGAGAAAGG + Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928619844 2:33077503-33077525 CCAGAGCAGGAGGAAGAGAGAGG + Intronic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929113316 2:38423465-38423487 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
930256310 2:49096877-49096899 CCAGAGCAGGAGCAAGAAAGTGG - Intronic
930586891 2:53277789-53277811 CTTGAGCAGGAGCAAGATTGTGG + Intergenic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
931110992 2:59111366-59111388 CTTTGGAAGCAGCAAGAGAGAGG - Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931966136 2:67536863-67536885 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
932039461 2:68283819-68283841 CTGGAGCATAGGGAAGAGAGAGG - Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
934626162 2:95855891-95855913 CTGGAGAAGCAAAGAGAGAGCGG - Exonic
934918045 2:98316821-98316843 CCAGAGCAGAAGGAAGAGAGGGG - Intergenic
934988672 2:98905288-98905310 CAAGAGAGGCAGCAAGAGAGAGG - Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935228614 2:101076978-101077000 TGGGAGCAGGAGCAAGAGAGAGG + Intronic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
937334535 2:121053906-121053928 CCAGAGCAGGAGCAAGAGAGTGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938227535 2:129628615-129628637 CGAGAGCGGGAGCAAGAGAGAGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938730643 2:134144337-134144359 CCAGAGCAGGAGGAAGAGAGAGG + Intronic
938797527 2:134730883-134730905 CTGGAGCAGGAGCAAAAGAGAGG - Intergenic
938936667 2:136133342-136133364 CTGGAGCAGCTGTAAGAAATGGG - Intergenic
938960309 2:136334902-136334924 TGGGAGCAGGAGCAAGAGAGAGG + Intergenic
939739060 2:145883865-145883887 CAAAAGCAGGAGCAAGAGAGAGG - Intergenic
940127355 2:150341542-150341564 CTGGAACAGGAGGAAGAGAGAGG - Intergenic
940179171 2:150913128-150913150 CTGGATCAAGAGCAAGACAGAGG - Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940449962 2:153824834-153824856 CTGGAGCAGGAGGGACAGAGAGG - Intergenic
940646556 2:156398426-156398448 TCAGAGCAGCAACAAGAGAGTGG + Intergenic
941709633 2:168698451-168698473 GTGGAGCAGAAGCAAAAGAGAGG + Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942473852 2:176293587-176293609 CAAGAGCAGGAGCAAGAGAAGGG - Intronic
943495002 2:188609431-188609453 CTGGAGCAAAAGGAAGACAGAGG + Intergenic
943587479 2:189758415-189758437 CAGGAGCAGGACCGAGAGAGGGG - Intronic
943687060 2:190829755-190829777 TAGGAGCAGGAGCAAGAGGGTGG + Intergenic
944135151 2:196391083-196391105 AGGGAGCACCAGCAAGAGACAGG + Intronic
944339448 2:198578739-198578761 CTGGAGCACCAGGAAGCCAGTGG - Intergenic
944803531 2:203259464-203259486 CAAAAGCAGGAGCAAGAGAGAGG - Intronic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945071419 2:205992637-205992659 CAGGAGCAAGAGCAAAAGAGAGG + Intergenic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945529653 2:210935540-210935562 CAAGAGCAGAAGAAAGAGAGAGG + Intergenic
945589776 2:211715682-211715704 CCAGAGCAGGAGGAAGAGAGAGG - Intronic
945751791 2:213795770-213795792 CTAGAGTAGGAGCAAGACAGAGG - Intronic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
946501244 2:220249599-220249621 TGAGAGCAGGAGCAAGAGAGTGG - Intergenic
946837513 2:223787136-223787158 CTGAAGCAGGAAGAAGAGAGAGG - Intronic
946876887 2:224138462-224138484 CAGGAGCAGGAACAAGAGTGAGG + Intergenic
947082034 2:226409734-226409756 CCAGAGCAGGAGAAAGAGAGAGG + Intergenic
947103445 2:226645826-226645848 TTGGAGCAGCAGCAATAGGTTGG - Intergenic
947274357 2:228373430-228373452 CCAGAGCAGGAGGAAGAGAGGGG + Intergenic
947288979 2:228550555-228550577 CAGGAGCAACAGCGAGAGAGTGG - Intergenic
947805818 2:232967179-232967201 CAGGAGCAGGAGCAAGGGAGTGG - Intronic
948091238 2:235297644-235297666 CTGGAGTAGGAGCAAGAGAGAGG + Intergenic
948126934 2:235571063-235571085 TTGGAGTAGGAGTAAGAGAGGGG + Intronic
948210072 2:236186304-236186326 CAAGAGCAGAAACAAGAGAGTGG - Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948319441 2:237057894-237057916 CAGGAGCAGGAGGAAGAGAGAGG - Intergenic
948377934 2:237534342-237534364 TTGGAGCGGAACCAAGAGAGGGG - Intronic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948877426 2:240837101-240837123 CTGGAGCTGCAGCATGGCAGTGG + Intergenic
1168746794 20:250132-250154 CCAGAGCAGGAGCAAGAGAGTGG - Intergenic
1169219228 20:3811883-3811905 CTGGGGCAGCAGGAAGGGAGGGG + Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169643293 20:7779142-7779164 CCAGAGCAGGAGCAAGAGAGTGG - Intergenic
1169792166 20:9422803-9422825 CTGCATAAGGAGCAAGAGAGAGG + Intronic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170466575 20:16627842-16627864 CTGGAGAAGGAGCAAGAGAGAGG + Intergenic
1170556701 20:17520623-17520645 CTGAGGCAGAGGCAAGAGAGAGG - Intronic
1170930881 20:20768575-20768597 CTGGGCCAGCAGCCACAGAGGGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171053802 20:21886426-21886448 CAGGAGCAGGACCAAGAGAGAGG + Intergenic
1171115355 20:22520615-22520637 CTGGTGCAGCAGCATGTGTGTGG + Intergenic
1171522208 20:25784480-25784502 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171529957 20:25846425-25846447 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171536706 20:25898917-25898939 GAGGAGCAGGAGCATGAGAGGGG + Intergenic
1171554619 20:26071403-26071425 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1172327184 20:34045434-34045456 CTGGAGTAGCAGCAGTAAAGAGG + Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173466085 20:43282497-43282519 CTGGAGCAGAAGAAACAAAGAGG + Intergenic
1173479422 20:43387586-43387608 CGGAAGCAGCAGCAAGGAAGAGG + Intergenic
1173590822 20:44223274-44223296 CAAGAGCAGGAACAAGAGAGAGG - Intergenic
1173872362 20:46350140-46350162 CTGGAATCGCAGCAGGAGAGGGG - Exonic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174444090 20:50578910-50578932 GGGGAGCAGGAGCAAGAGATGGG + Intronic
1174735698 20:52963824-52963846 CGAGAGAAGCAGCCAGAGAGAGG - Intergenic
1174799356 20:53550244-53550266 CGGGAGCAGGAGCAAGAGTTGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175120820 20:56715085-56715107 CTTGAGCATCAGTGAGAGAGGGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175402693 20:58709523-58709545 CTGGAACTGGAGCATGAGAGTGG + Intronic
1175423804 20:58852100-58852122 CTGCGGCGGCACCAAGAGAGGGG - Intronic
1175945347 20:62555947-62555969 CTGGCGTAGCAGCAAGGGGGCGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176183277 20:63763506-63763528 CAGGAGCAGGAGCAAGACGGAGG + Intronic
1176656011 21:9589477-9589499 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1177179922 21:17734119-17734141 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177722533 21:24927031-24927053 CCAGAGTAGGAGCAAGAGAGAGG - Intergenic
1178412541 21:32377578-32377600 GTGGTGGAGCAGCATGAGAGTGG - Intronic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178685339 21:34706233-34706255 CCAGAGCAGGAGCAAGAGAGAGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178879696 21:36439564-36439586 CTCGTGCAGCAGCCAGAGAGAGG - Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179052973 21:37904949-37904971 CTGCTGCAGCAGCCAGATAGGGG - Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179813809 21:43890237-43890259 CCAGAGCAGCAGGAAGACAGAGG - Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180101748 21:45590780-45590802 CTGGAGCAGGAGCCTGGGAGAGG - Intergenic
1180151056 21:45948122-45948144 CTGCAGCAGCCTCAGGAGAGGGG - Intergenic
1180188852 21:46153294-46153316 CAGGAGCAGCAGCACCTGAGCGG + Intronic
1180413268 22:12636378-12636400 CAAGAGCAGGAGGAAGAGAGAGG + Intergenic
1180973747 22:19832627-19832649 CTGGGGCAGCACCGTGAGAGAGG - Intronic
1181932879 22:26417032-26417054 TTGCAGCTGCAGAAAGAGAGAGG + Intergenic
1182358230 22:29732164-29732186 CTGGAGAAGCAGCATGCGTGGGG - Intronic
1182467467 22:30526161-30526183 CTGCAGGGGCAGTAAGAGAGGGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182759491 22:32710685-32710707 CCAGAGCAGAAGGAAGAGAGAGG - Intronic
1182938457 22:34249923-34249945 CAAAAGCAGGAGCAAGAGAGAGG - Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183221268 22:36514984-36515006 CCAGAGCAGGAGAAAGAGAGGGG - Intronic
1183271453 22:36865081-36865103 CTGCAGCAGCAGGACGGGAGTGG - Intronic
1183297917 22:37043079-37043101 CAGGAGCAGCAGGAAGGTAGAGG + Intergenic
1183300671 22:37057560-37057582 CTGGGGCTGCAGGAAGGGAGGGG - Intronic
1183512167 22:38242681-38242703 CAGAGGCAGCTGCAAGAGAGGGG + Intronic
1184055271 22:42043332-42043354 CAGGTGCAGCAGCAAGGGACTGG + Intronic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1184194307 22:42916483-42916505 CCGGAGCAGGGGCAGGAGAGAGG - Intronic
1184437831 22:44490334-44490356 CTGGAGCAGGTGCAGGAGAGAGG + Intergenic
1184953910 22:47867810-47867832 TTAGAGCAGCAGCAAGAAAATGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185197131 22:49478691-49478713 CCAGAGCAGGAGGAAGAGAGGGG + Intronic
949128284 3:471913-471935 CTGGAGCAGGAGCAAGAAGGAGG - Intergenic
949267435 3:2174843-2174865 CAAAAGCAGGAGCAAGAGAGTGG + Intronic
949607036 3:5664547-5664569 TGGGAGCAGGAGCAAGAGAAGGG + Intergenic
949698707 3:6730331-6730353 GTGGAACAGGAGGAAGAGAGAGG + Intergenic
949850859 3:8418923-8418945 CTGGAGAAGGAGCAAAAGAGTGG - Intergenic
950732461 3:14972814-14972836 CAGGGGCAGGACCAAGAGAGTGG + Intronic
951133500 3:19075948-19075970 CAGGAGCTGGAGCAAGAAAGAGG - Intergenic
951306851 3:21074385-21074407 CAGGAGCAGGAGCAAGAGAGAGG + Intergenic
951638926 3:24812205-24812227 CTGGTGCAGCTTCAAGAGTGAGG - Intergenic
951808637 3:26675415-26675437 CTGGAGCACCAGGAAGACAGTGG - Intronic
951860918 3:27251491-27251513 CCAGAGCAGGAGCAGGAGAGGGG - Intronic
951990954 3:28675755-28675777 CAGAAGCAGCACCGAGAGAGAGG - Intergenic
952016710 3:28965355-28965377 CAAAAGCAGGAGCAAGAGAGAGG - Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
952971928 3:38656744-38656766 CTGGAGGAGGAGCTAGAGGGAGG + Intergenic
953063550 3:39448620-39448642 ATAGAGAAGCAGCAAAAGAGTGG + Intergenic
953202157 3:40787321-40787343 CTGGAGCAGCAGGGATAGGGAGG - Intergenic
953764749 3:45729703-45729725 CCTGAAAAGCAGCAAGAGAGAGG - Intronic
953792902 3:45962103-45962125 CTGAGACAGCAGCAAGAAAGTGG + Intronic
953812998 3:46130430-46130452 ATGGAGCAGACGCAAGAGTGGGG + Intergenic
954475138 3:50737310-50737332 CAGGAGCAGGACCAAGACAGGGG + Intronic
954596093 3:51826276-51826298 CATGAGCAGGAGGAAGAGAGAGG + Intronic
954881306 3:53837698-53837720 GTGGTGAAGCAGCTAGAGAGTGG - Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955130158 3:56157991-56158013 CCTGAGCACCAGCAAGGGAGAGG + Intronic
955591974 3:60546731-60546753 CTGGAAGATCAGGAAGAGAGTGG - Intronic
955725311 3:61926383-61926405 CTGGAGTAGGAGCAAGAGAGAGG - Intronic
956724893 3:72148855-72148877 CCAGAGCAGAAGCAAGAGAAAGG + Intergenic
956967140 3:74474886-74474908 CCAGAGCAGGAGCAAGAGAACGG - Intronic
957212082 3:77272393-77272415 CAGGAGCAGGAGGAAGAGAAGGG + Intronic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
958540184 3:95461182-95461204 CTGGAGCAGGAGGGATAGAGAGG + Intergenic
958721296 3:97847033-97847055 CAAGAGCAGGAGCAAGAGAGAGG + Intronic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
959064472 3:101642661-101642683 CCGGAGCAGGAGGAAGAGAGTGG - Intergenic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
959346462 3:105201210-105201232 CCAGAGCAGTAGAAAGAGAGTGG + Intergenic
959426890 3:106201404-106201426 CTGGAACAGGAGGAAGACAGTGG - Intergenic
959838432 3:110947885-110947907 CTGGAACAGGAGCTAGAGAGTGG - Intergenic
960134741 3:114093920-114093942 TTGGTACAGCAGGAAGAGAGTGG - Intergenic
960442165 3:117702176-117702198 TGGCAGCAGGAGCAAGAGAGAGG - Intergenic
960462336 3:117951817-117951839 CTGGATCAGGAGGAAGACAGCGG - Intergenic
960520062 3:118644348-118644370 CAGGAGCAGGAGGAAGAGAGGGG + Intergenic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
961084783 3:124057514-124057536 CAGAAGGAGCAGGAAGAGAGAGG + Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
962161856 3:133009378-133009400 CCAGAGTAGGAGCAAGAGAGGGG - Intergenic
962214347 3:133507475-133507497 CTGGTGCTGTAGCAAGAGTGTGG - Intergenic
962302130 3:134252038-134252060 TTGGAGCCTCACCAAGAGAGGGG - Intergenic
962314520 3:134350880-134350902 CAGGGGCAGCAGCAAGGGAAGGG - Intergenic
962657687 3:137565404-137565426 CCAGAGCAGGAGCAAGAAAGAGG - Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963264174 3:143222763-143222785 ATGGAGTAGCTGCAAGACAGAGG + Intergenic
963410106 3:144916638-144916660 CTTGGCCAGCAGTAAGAGAGAGG + Intergenic
963500442 3:146119195-146119217 TTGGAGCAGGAGGAAGTGAGGGG - Intronic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
964394314 3:156229300-156229322 CCAGAGCAGGAGGAAGAGAGTGG + Intronic
964395572 3:156242250-156242272 CAGAAGCACCAGCAAGAGAATGG - Intronic
964396974 3:156255968-156255990 CTGGAGCAGCGCCCAGAGTGCGG + Intronic
964495547 3:157286044-157286066 CTTGAGCAGCAGAAAGGAAGTGG + Intronic
964507172 3:157412051-157412073 CCAGAGCAGGAGGAAGAGAGAGG - Intronic
964847515 3:161059839-161059861 CTGGAGCAGAAGGAAGTGGGTGG - Intronic
964852992 3:161115191-161115213 CAAAAGCAGGAGCAAGAGAGGGG + Intronic
965074821 3:163962985-163963007 CCAGAGCAGAAGGAAGAGAGAGG - Intergenic
965756700 3:172034884-172034906 CTGAAGCAGGACCTAGAGAGAGG + Intergenic
965813897 3:172617506-172617528 CTGGAGCAGGAGCAAGTTGGGGG + Intergenic
965990279 3:174809956-174809978 CAGGAGCAGGACCAAGAGAGGGG - Intronic
966256133 3:177918061-177918083 CTGGACCAGCAGCTACAGAGAGG + Intergenic
966358583 3:179109181-179109203 CAAGAGCAGGAGCAAGAGAGAGG + Intergenic
966782146 3:183593099-183593121 CCAGAGCAGGAGCCAGAGAGGGG - Intergenic
967521087 3:190433927-190433949 CTGGGCCAGGAGGAAGAGAGTGG - Intronic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968427994 4:535765-535787 GTGGAGCAGAAGCCAGAGGGCGG - Intronic
968522699 4:1041215-1041237 CGGGAGCAGCAGGAGGGGAGCGG - Intergenic
968904493 4:3445143-3445165 CTGGAGCAGTGGGAAGAGAGTGG - Intronic
969402282 4:6963375-6963397 CCGGAGCAGCAGCACCAGTGTGG + Intronic
969984007 4:11188330-11188352 CAGGAGGAGAGGCAAGAGAGAGG - Intergenic
970020941 4:11567947-11567969 CCTGAGCAGGAGGAAGAGAGAGG + Intergenic
970417545 4:15874275-15874297 CAGGAGCAGGAGGAAGAGAGAGG - Intergenic
970475251 4:16415604-16415626 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
970855928 4:20649461-20649483 CTGGAATAGGAGCAAGAGAGGGG - Intergenic
971103831 4:23499388-23499410 CAGGAACAGGACCAAGAGAGTGG - Intergenic
971185642 4:24373163-24373185 CGTGAGCAGCAGGAAAAGAGAGG + Intergenic
971213717 4:24644337-24644359 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
971326893 4:25652167-25652189 CCGCAGCTGCTGCAAGAGAGGGG - Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971945189 4:33266146-33266168 TGGAAGCAGGAGCAAGAGAGAGG - Intergenic
972734336 4:41826186-41826208 CTGGAGGAGGAGCAAGTGGGTGG - Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972976504 4:44642748-44642770 CAGGAGCAGGATCGAGAGAGAGG - Intronic
973091120 4:46137571-46137593 TGAGAGCAGGAGCAAGAGAGGGG - Intergenic
973177881 4:47230456-47230478 CTAGAGCAGCAGGAAGAGAGAGG + Intronic
973277197 4:48322595-48322617 CAGGAGCAGGACCGAGAGAGAGG - Intergenic
973543167 4:51954315-51954337 TTGGAGCAGGAGGAAGAGAGAGG - Intergenic
973696332 4:53494382-53494404 CTTTATCAGCAGCAAGAGAATGG + Intronic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974636698 4:64572872-64572894 CAAAAGCAGGAGCAAGAGAGAGG - Intergenic
975423883 4:74203603-74203625 CTGGAGCAGGAAGAAGAGATGGG + Intronic
975609643 4:76191507-76191529 CCAGAGCAGGAGCAAGAGAGGGG - Intronic
975615052 4:76237759-76237781 CCAGAGCAGGAGCAAGAGAGAGG + Intronic
975684527 4:76906516-76906538 CAAAAGCAGGAGCAAGAGAGAGG + Intergenic
976061830 4:81137646-81137668 CAGGAGCAGAAGCAAGGCAGTGG - Intronic
977034170 4:91928299-91928321 CTGGAGCAGGAGGAAGGGGGTGG - Intergenic
977269603 4:94899997-94900019 CTAGATTTGCAGCAAGAGAGAGG + Intronic
977631814 4:99251420-99251442 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
977875869 4:102149225-102149247 CTGGAGTGGGAGGAAGAGAGAGG - Intergenic
978160151 4:105537077-105537099 CCAGAGCAGGAGGAAGAGAGTGG - Intergenic
978465573 4:109005201-109005223 TCAGAGCAGCAGCAAGAGAGAGG + Intronic
978540026 4:109806418-109806440 CTGGAGTAGGAGCAAGAGAGAGG - Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979721595 4:123906133-123906155 GTGGAGCAGAAGAGAGAGAGAGG - Intergenic
979969406 4:127115227-127115249 CCAGAGCAGAAGGAAGAGAGTGG - Intergenic
980406603 4:132361055-132361077 CCACAGCAGGAGCAAGAGAGAGG - Intergenic
980700970 4:136429391-136429413 CTGGTGCAGGAACAAGAGAGGGG - Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
981171576 4:141631074-141631096 TGAGAGCAGGAGCAAGAGAGAGG - Intergenic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
981912326 4:149995752-149995774 CTAGAGCAGGAGCAAAAGAGAGG - Intergenic
982087381 4:151849604-151849626 CCAGAGCAGGAGAAAGAGAGAGG - Intergenic
982106621 4:152016891-152016913 TTGGAGGAGAAGTAAGAGAGTGG - Intergenic
982271913 4:153599189-153599211 CTAAAGCAGGAGCACGAGAGGGG + Intronic
983358997 4:166703823-166703845 CAAAAGCAGGAGCAAGAGAGGGG + Intergenic
984660840 4:182373496-182373518 CAAGAGCAGGAGCAAGAGAAAGG + Intronic
984736575 4:183114193-183114215 CCAGAGCAGGAACAAGAGAGAGG - Intronic
985243013 4:187950816-187950838 TGGGAGCAGAAGCAAGAGAGAGG + Intergenic
985953774 5:3244589-3244611 TGAGAGCAGAAGCAAGAGAGAGG + Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986355030 5:6915595-6915617 CAGGAGCCACAGCAAGAGAGAGG + Intergenic
986536400 5:8792582-8792604 CCAGAGTAGGAGCAAGAGAGAGG - Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987242952 5:16019736-16019758 CTGGAGCAGCATGAAGGGAAGGG - Intergenic
987553385 5:19413100-19413122 CAGGAGCAGGAACAAGAGAGTGG - Intergenic
987759191 5:22137407-22137429 CTAAAGCAGCATCCAGAGAGAGG - Intronic
987914329 5:24191672-24191694 CGAGAGCAGGAGCAAGAGAGAGG - Intergenic
988167862 5:27617322-27617344 CTGGAGCTTCAGCAATACAGGGG - Intergenic
989057538 5:37379466-37379488 CTGGAGCAAGAGGAAAAGAGAGG - Intronic
989087873 5:37695151-37695173 CAGGAGCAGGAGTAAGAGAAGGG + Intronic
989193146 5:38690685-38690707 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
989350455 5:40479976-40479998 CTGGGGCAGCAGCATTTGAGAGG + Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
990184379 5:53197753-53197775 CTGGAGAAGTAGCAGGAAAGAGG - Intergenic
991057852 5:62339193-62339215 GGGGAGCAGGAGCAAGAGAGAGG + Intronic
991172582 5:63646018-63646040 CTGGAGCAGGAGGAAGACAGAGG + Intergenic
991340134 5:65600046-65600068 CAGGAGCAGGAGCAAGAGAGAGG + Intronic
991579102 5:68135609-68135631 CAGGTGCAGCAGAAAGACAGTGG + Intergenic
991893904 5:71370854-71370876 CTAAAGCAGCATCCAGAGAGAGG - Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992666415 5:79013767-79013789 CAGGAGCAGGAGCAAGAGACAGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
992905143 5:81338433-81338455 CTAGAGCAGGAGGAAGAGAGAGG - Intronic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993254071 5:85565079-85565101 AAGGAGCAGGAGCAAGAGAGAGG - Intergenic
993344827 5:86769840-86769862 CTGGAGCAGGAGGAAAAGAGAGG + Intergenic
993468485 5:88277223-88277245 GGGGAGCAAGAGCAAGAGAGAGG - Intergenic
994026483 5:95090429-95090451 CTGGAGCAGCAGCATTTAAGCGG - Intronic
994474621 5:100250828-100250850 CGGGAGCAGGAGGAAGAGAGAGG - Intergenic
994511476 5:100709295-100709317 CTGCAGGAGCAGCAAGTTAGGGG + Intergenic
994558725 5:101339066-101339088 CTGGACCAGGAGGAAGAAAGAGG + Intergenic
994935922 5:106254116-106254138 CCAGAGCAGGAGGAAGAGAGGGG - Intergenic
995860216 5:116633303-116633325 CCAGAGCAGGAGCAAGAGAGAGG - Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996647310 5:125831704-125831726 CCGGAGCAGTAGGCAGAGAGAGG - Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996782841 5:127207295-127207317 CCAGAGCAGGGGCAAGAGAGAGG - Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997032293 5:130144988-130145010 CTGGTGCAGGAGGAAGAGAGAGG + Intronic
997305881 5:132836121-132836143 CCAGAGCAGAAGCAAGAGAGGGG - Intergenic
997366723 5:133330416-133330438 CAAGAGCAGGGGCAAGAGAGTGG + Intronic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
997411259 5:133692739-133692761 AGGGAGCAGCAGGAAGTGAGAGG - Intergenic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
998941551 5:147288611-147288633 TGGGAGCAGGAGCAAGAGAGAGG + Intronic
999059371 5:148617236-148617258 CCAAAGCAGGAGCAAGAGAGAGG - Intronic
999124711 5:149238752-149238774 CTGGTGCAGCAGCTGGAGATGGG - Intronic
999462034 5:151765976-151765998 CTGAAGCAGCAGCAATGGAGGGG + Intronic
999533796 5:152493874-152493896 CTGGGGCAGGAGGAAGAGAGAGG + Intergenic
1000016478 5:157282274-157282296 TGGAAGCAGGAGCAAGAGAGTGG + Intronic
1000610527 5:163368604-163368626 CAAGAGAAGAAGCAAGAGAGAGG - Intergenic
1001471534 5:172016843-172016865 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
1002479461 5:179490412-179490434 CAGGAGCAGCGGCGAGAGAACGG + Intergenic
1003058113 6:2841402-2841424 CTGCAGCTGCAGGGAGAGAGAGG - Intronic
1003191583 6:3879714-3879736 CCGGAGCAGAAGTAAGCGAGTGG - Intergenic
1003398529 6:5773141-5773163 CAGGAGCAGGACCAAGAGGGTGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1003946505 6:11080840-11080862 CCGGAGCAGGAGCAAGACAGAGG + Intergenic
1004227614 6:13801090-13801112 CTGGGGCAGGAGCAACTGAGAGG + Intronic
1004496764 6:16171610-16171632 CTGTAGCAGCAGTAAAATAGAGG + Intergenic
1004523559 6:16384712-16384734 CTGGAGCAGGAGGAAGGGAAAGG - Intronic
1004583812 6:16980007-16980029 CAGCAGCTGCAGCAAGAGACTGG - Intergenic
1004777132 6:18860339-18860361 TGAGAGCAGGAGCAAGAGAGAGG + Intergenic
1005685700 6:28251619-28251641 CGGGAGCAGCATCCAGAGAGCGG - Exonic
1005696909 6:28359905-28359927 CGGGAGCAGCATCCAGAGAGCGG + Exonic
1005700710 6:28398065-28398087 CAGGAGCAGCATCCAGAGAGTGG - Exonic
1006204350 6:32327134-32327156 GTGGAGCAGCAGCTAAATAGAGG + Intronic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007827163 6:44609149-44609171 AAGGCACAGCAGCAAGAGAGAGG + Intergenic
1008104491 6:47427668-47427690 CTGGAGCAGGAGCAAGATGTGGG + Intergenic
1008923081 6:56863080-56863102 CTGGAGCTGCTGCGAGTGAGTGG + Intronic
1009022650 6:57961225-57961247 CTGGAGCAAGAGGAAAAGAGAGG + Intergenic
1009635479 6:66259643-66259665 CTGGGGGAGCAGCCAGAGAGTGG + Intergenic
1009694867 6:67089182-67089204 CTTGTGCAGCAGCAACATAGTGG + Intergenic
1010466921 6:76178670-76178692 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1010529556 6:76950897-76950919 CTGGCACAGCAGCAAGTGTGGGG - Intergenic
1010678227 6:78768726-78768748 CGGAAGCAGGAGGAAGAGAGAGG - Intergenic
1011298339 6:85847586-85847608 CTGAAGCAGCTCCAAGAAAGAGG + Intergenic
1011645672 6:89455685-89455707 CCAGAGCAGGAGGAAGAGAGAGG - Intronic
1012210090 6:96508875-96508897 CTGAAGCAGGGGGAAGAGAGAGG - Intergenic
1012409658 6:98942537-98942559 CAGGAGCAGAAGGAAGAGAGTGG - Intronic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1012705511 6:102523608-102523630 CAGGAGCAGAAGCAAGAGAGAGG - Intergenic
1013290284 6:108713413-108713435 CTGAAGCAGCCTGAAGAGAGTGG - Intergenic
1014075672 6:117231473-117231495 CCGGAGCAGGAGGAAGAGAGAGG + Intergenic
1014506838 6:122269649-122269671 CAGGAGCAGGAGCAAGAGAGGGG + Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015880293 6:137865382-137865404 AAGGAGCACCAGCAGGAGAGTGG + Intergenic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1015983459 6:138862354-138862376 CAAGAGCAGGAACAAGAGAGAGG + Intronic
1016153369 6:140772095-140772117 ATGGAGCAGGAAGAAGAGAGAGG + Intergenic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1016598271 6:145826102-145826124 CAGGAGCAGGACCGAGAGAGAGG - Intergenic
1017054134 6:150423020-150423042 CCGGAGCAGCGGCAAGACACCGG - Intergenic
1017108597 6:150911627-150911649 CCAGAGCAGGAGCAAGAGAGAGG + Intronic
1017350246 6:153432501-153432523 CTGGAGTAGATGGAAGAGAGGGG - Intergenic
1017530740 6:155289901-155289923 CTGGAGCAGTAGGAAGAGAGTGG - Intronic
1017589190 6:155960140-155960162 CAGAAGCAGCAGGAAGAGACAGG - Intergenic
1017812883 6:157996769-157996791 CAGGAGCAGGACCAAGAGGGTGG - Intronic
1017989316 6:159472396-159472418 CTGGATCAGGAGGAAGAGAGAGG + Intergenic
1018035745 6:159879599-159879621 CCAGAGCAGGAGGAAGAGAGTGG + Intergenic
1018109744 6:160523573-160523595 CAGGAGCAGGAGCAAGGGTGGGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018953877 6:168395251-168395273 CTGGAGCAGCAGGCGGGGAGGGG - Intergenic
1019436839 7:1026709-1026731 CTGGAGCGGCAGCAACTGAGGGG - Intronic
1019448957 7:1086636-1086658 CTGGTGCAGGTGCAAGAGTGGGG - Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019830893 7:3329049-3329071 GTCTAGCAGTAGCAAGAGAGGGG - Intronic
1019955358 7:4410179-4410201 AAGGAGCGGCAGCAAGAGAAAGG + Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1020017743 7:4841356-4841378 CTAGAACAGCAGCCAGGGAGGGG + Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020066188 7:5190251-5190273 CTGGAGCATAAACAAGAGCGGGG + Exonic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1020866767 7:13574156-13574178 CAGGAGCAGGAGGAAGAGAGGGG - Intergenic
1021763057 7:23920109-23920131 CTAGAGCAGGAGCAAGAGAGGGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022724308 7:32966798-32966820 CAAGAGCAGGAGCAAGAGAGAGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022907832 7:34873563-34873585 TCAGAGCAGGAGCAAGAGAGAGG + Intronic
1022992462 7:35721860-35721882 CTGGACAAGCAGGAAGAAAGAGG - Intergenic
1022998631 7:35784804-35784826 ATGGAGGGGCAGAAAGAGAGGGG - Intergenic
1023200722 7:37694248-37694270 CAGGTGCAGCAGCAAGTGGGAGG + Intronic
1023930027 7:44699861-44699883 CCAGAGCAGGAGTAAGAGAGTGG + Intronic
1024024036 7:45396316-45396338 CTGGGTGAGGAGCAAGAGAGAGG - Intergenic
1024195566 7:47055353-47055375 GAGGAGGGGCAGCAAGAGAGAGG - Intergenic
1024304246 7:47913600-47913622 CCGGAGTAGGAGCAAGAGGGGGG - Intronic
1024681896 7:51698972-51698994 CTGGAGCTCCAGGTAGAGAGAGG + Intergenic
1025282698 7:57639655-57639677 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1025302019 7:57825762-57825784 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1026292183 7:69017764-69017786 GGAGAGCAGGAGCAAGAGAGAGG + Intergenic
1026304592 7:69129638-69129660 TGGGAGCAGGAGGAAGAGAGAGG + Intergenic
1026363932 7:69628661-69628683 CTAGAGCAGGAGAAAGGGAGAGG + Intronic
1026504528 7:70970886-70970908 CCGGAGCAGGAGCAAAAGAGGGG - Intergenic
1026601630 7:71782326-71782348 CAAGAACAGGAGCAAGAGAGAGG - Exonic
1026651807 7:72222399-72222421 CAAAAGCAGGAGCAAGAGAGAGG + Intronic
1027051128 7:75021788-75021810 CTGGTGCACCAGCCAGAGCGAGG - Intronic
1027342148 7:77221041-77221063 CAGGAACACAAGCAAGAGAGAGG + Intronic
1027409581 7:77901039-77901061 CCAGAGCAGGAGCCAGAGAGTGG + Intronic
1027595659 7:80170640-80170662 CTGGAGTAGGAGGAAGAGAGAGG + Intronic
1027636359 7:80680217-80680239 AGGGAGCAGGAGCAAGGGAGGGG + Intergenic
1027880456 7:83828883-83828905 CAAAAGCAGGAGCAAGAGAGTGG - Intergenic
1028167607 7:87556606-87556628 CTGGAGCAGAGGCAGGAGAGGGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028792291 7:94866691-94866713 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
1029593167 7:101520726-101520748 CTGGGGAAGGAGCATGAGAGGGG - Intronic
1029670714 7:102028742-102028764 CGGGAACAGCAGCCATAGAGGGG + Intronic
1029917747 7:104229879-104229901 CTGGAGCAGCAGTAAAGGTGTGG + Intergenic
1030676895 7:112393774-112393796 AGGGAGCAGGAGCAAGAGAGAGG - Intergenic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031429647 7:121651330-121651352 CTGGAGCAGGAGCAAGGGGTAGG - Intergenic
1032464011 7:132132229-132132251 CAGGAGCAGCTGGGAGAGAGAGG - Intronic
1032482215 7:132256268-132256290 CTGAGGCAGCAGCAAGAAAACGG + Intronic
1032710074 7:134453408-134453430 CTGGAGCTGCTGCAGGAAAGTGG + Intronic
1032894471 7:136235483-136235505 CTGGAGAAGGAGCAAGAAAGAGG + Intergenic
1033078608 7:138272771-138272793 CTGGAGCAGGAGGAACAGTGGGG + Intergenic
1033146363 7:138873659-138873681 CTGGAGCAGCAGCCTAAGACTGG + Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1033424982 7:141236029-141236051 CTGGATCACCAGCAAGAGATGGG + Intronic
1033529474 7:142247747-142247769 AGGGAGGAGCAGGAAGAGAGAGG + Intergenic
1033771537 7:144557989-144558011 CAAAAGCAGAAGCAAGAGAGTGG - Intronic
1034412056 7:150947003-150947025 CTGTAGCAGCTGCAGGACAGTGG + Exonic
1034524625 7:151649702-151649724 CGGGAGCAGGAGCAAGAAGGAGG - Intronic
1034536948 7:151731321-151731343 CTGGCTCTGCAGCCAGAGAGGGG + Intronic
1034778297 7:153852409-153852431 CCGGAGCAGGAGCAAGAGAGTGG + Intergenic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1036120023 8:6006210-6006232 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1036134662 8:6149660-6149682 CCAGAGCAGGAGCAAGAGAGGGG + Intergenic
1036640518 8:10580611-10580633 CGGGAGCAAGAGCAAGGGAGGGG - Intergenic
1036647770 8:10622903-10622925 CTGGAGCAGCTGGAAGATGGAGG - Exonic
1036913713 8:12784429-12784451 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1037016706 8:13916362-13916384 CAGGAGCAGGAGGAAGAGAGAGG - Intergenic
1037086490 8:14857131-14857153 CTGGATCATGAACAAGAGAGAGG - Intronic
1037731974 8:21533727-21533749 TGAGAGCAGCAACAAGAGAGAGG + Intergenic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1038355198 8:26822849-26822871 CTGGAGCAGAAGCAAGAAAGTGG + Intronic
1038680963 8:29667624-29667646 CTGGGGCAGCAGCAAGAGCCGGG + Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1038857290 8:31347732-31347754 CTGGAGCAGAAGATAGAGAGAGG - Intergenic
1039156466 8:34564227-34564249 CAGGAGCAGGAGTGAGAGAGAGG - Intergenic
1039301579 8:36214952-36214974 CTGTAGCAGAAGTCAGAGAGAGG - Intergenic
1039402991 8:37287431-37287453 CCAGAGCAGGAGGAAGAGAGAGG - Intergenic
1039506978 8:38059311-38059333 AGGAAGCAGGAGCAAGAGAGAGG - Intronic
1039671200 8:39601064-39601086 CCAGAGCAGGAGGAAGAGAGAGG + Intronic
1039818513 8:41115782-41115804 CTGGAGAAAGAGCAAGAGTGGGG - Intergenic
1039937256 8:42056430-42056452 CTGGAGCAGCAGCAAAAAAGAGG - Intergenic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1040767548 8:50931941-50931963 CTGGAGCAGGAGCAAGAAAATGG - Intergenic
1040911797 8:52527189-52527211 CCAGAGCAGGAGCAAGAGAGAGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041223348 8:55673654-55673676 CCAGAGCAGGAGCAAGAGAAAGG + Intergenic
1041488452 8:58405375-58405397 CTGGAGCAGGAGGAAGTGTGGGG - Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042721949 8:71835382-71835404 CTAGAGAGGGAGCAAGAGAGAGG + Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043334350 8:79155656-79155678 CGAGAGCAGGAGCAAGAGAGAGG - Intergenic
1043338026 8:79201510-79201532 CTGGACCAGCAGGGTGAGAGAGG - Intergenic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043808272 8:84701636-84701658 CTGGAGGATCAGGAAGAGAGGGG + Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1045320681 8:101079787-101079809 CTGGAAGAGCAGCAGGGGAGGGG + Intergenic
1045559105 8:103243871-103243893 CTGGAGCAGGAGGAAAAGTGGGG + Intergenic
1046134177 8:110004856-110004878 CCAGAGCAGGAGCAAGATAGAGG + Intergenic
1046146807 8:110171687-110171709 CTGGAGCAGCTGCAATGCAGGGG - Intergenic
1046311426 8:112442124-112442146 CAAGAGAAGGAGCAAGAGAGAGG + Intronic
1046398801 8:113676542-113676564 CTGCAGCAGCAGCCAGGCAGGGG - Intergenic
1046588984 8:116182722-116182744 TGCGAGCAGGAGCAAGAGAGAGG - Intergenic
1047484952 8:125320967-125320989 CCAGAGCAGGAGGAAGAGAGAGG + Intronic
1047574609 8:126138955-126138977 CAGAAGTAGGAGCAAGAGAGAGG - Intergenic
1047646404 8:126874854-126874876 CTGTAGCAGCCTCCAGAGAGGGG - Intergenic
1048014831 8:130488069-130488091 CCAGAGCAGGAGCAAGAGAGGGG + Intergenic
1048326886 8:133446786-133446808 ACGGAGCAGGAGCAAGGGAGAGG + Intergenic
1048370723 8:133773932-133773954 CTGGGGCAGCAGGAAGAGCGGGG + Intergenic
1048376130 8:133823994-133824016 TTGGAGCAGCAGTGAGAAAGTGG + Intergenic
1048614625 8:136059641-136059663 CTGTGGCAGCAGCAATACAGAGG - Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048878718 8:138856674-138856696 CAGGAGAGACAGCAAGAGAGAGG + Intronic
1048927168 8:139281452-139281474 TAGAAGCAGCAGCCAGAGAGAGG + Intergenic
1049101864 8:140585629-140585651 TTTAAGCAGCAGCAAGGGAGGGG - Intronic
1049148061 8:141016656-141016678 CTGGAGCAGGAGCAAGGGTGGGG + Intergenic
1049589534 8:143450652-143450674 CTGGAGCAGGAGGTCGAGAGAGG + Intronic
1049951065 9:644532-644554 CCAGAGCAGGAGGAAGAGAGAGG + Intronic
1050125043 9:2348016-2348038 CAGGAGAAGGAGCAAGAGTGGGG - Intergenic
1051040388 9:12802441-12802463 CCAGAGCAGAAGGAAGAGAGTGG - Intronic
1051510678 9:17874647-17874669 CTAGAGCAGGAGCAAGAGAGAGG + Intergenic
1051512056 9:17889153-17889175 CTGGAGTAGGAGCAAGAGAGAGG + Intergenic
1051921500 9:22271961-22271983 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1052549684 9:29932059-29932081 CAGGAGCAGGAGCAAGTCAGTGG + Intergenic
1052665345 9:31487858-31487880 CAGGAGCAGGACCAAGAAAGAGG + Intergenic
1052878523 9:33585333-33585355 CAGGAGTAGAAGCAAGACAGAGG - Intergenic
1052883175 9:33618179-33618201 CTGAAACAGAAGCCAGAGAGAGG - Intergenic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053086921 9:35232856-35232878 CTGGAGTAGAAGCTGGAGAGTGG + Intronic
1053497456 9:38558876-38558898 CAGGAGTAGAAGCAAGACAGAGG + Intronic
1053607823 9:39679020-39679042 CTGCAGCAGCAGCAAAAAGGCGG - Intergenic
1054245712 9:62663389-62663411 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054559837 9:66697920-66697942 CTGCAGCAGCAGCAAAAAGGCGG + Intergenic
1054837443 9:69692724-69692746 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1055951733 9:81735749-81735771 CTGGAGCAGAAGCAAGGGCTGGG + Intergenic
1055998995 9:82194170-82194192 CTAGAGCAGCAGACAGACAGTGG + Intergenic
1056109178 9:83377623-83377645 TGGGAGCAGGAGCAGGAGAGAGG - Intronic
1056188835 9:84164987-84165009 CTGGAGCCGAAGGAAGAGAGAGG - Intergenic
1056264313 9:84881035-84881057 GTGGAGATGCAGCCAGAGAGTGG + Intronic
1056502957 9:87228548-87228570 CAGGGGCAGAAGCAAGAGAGAGG - Intergenic
1056577991 9:87870575-87870597 CTGGAGCGGCAGCCAGGGAGAGG - Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057345901 9:94250469-94250491 CAAGAGCAGGAGAAAGAGAGAGG + Intergenic
1057351108 9:94299527-94299549 CTGGAGCAAAAGCAAGGGAGCGG + Intronic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057935635 9:99236399-99236421 CCCGAGCAGAAGGAAGAGAGAGG - Intergenic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058636365 9:107042244-107042266 CAAGAGAAGGAGCAAGAGAGAGG - Intergenic
1058774871 9:108273210-108273232 CTGCAGCAGGCGCATGAGAGTGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058899603 9:109430802-109430824 CATGAGGAGCAGCAGGAGAGGGG - Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059472221 9:114514320-114514342 CTGGAGCAGGAGGGAGAGAGAGG + Intergenic
1059653343 9:116335027-116335049 CCTGAGCAGCTGCCAGAGAGGGG + Exonic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1060702855 9:125774168-125774190 CCGGAGCAGGAGGAAGAGTGTGG + Intronic
1060976873 9:127770252-127770274 CTGGAGCAGGAGGAAGGAAGGGG - Intronic
1061395559 9:130341676-130341698 CTGGAGCAGTAACCAGGGAGTGG + Intronic
1061906904 9:133703629-133703651 CAGGAGCAGCGGCCAGGGAGGGG - Intronic
1062052310 9:134453983-134454005 TGGGAGCAGCAGCATGGGAGCGG + Intergenic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203633728 Un_KI270750v1:92937-92959 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1185815749 X:3153711-3153733 CTGGAGCAAGAGGGAGAGAGAGG + Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186051270 X:5598251-5598273 CAAGAGCAGGAGCAAGAGATGGG + Intergenic
1186257237 X:7735826-7735848 CCAGAGCAGGAGGAAGAGAGAGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186679908 X:11862001-11862023 CTGGAGCAGGAGCAAGGGGTTGG + Intergenic
1186685643 X:11922292-11922314 TCAGAGCAGGAGCAAGAGAGCGG + Intergenic
1187222406 X:17341100-17341122 CTGAAGCAGCAAAAAAAGAGAGG + Intergenic
1187400024 X:18951123-18951145 CAGGAACAGGAGGAAGAGAGAGG + Exonic
1187843033 X:23508563-23508585 CCAGAGTAGGAGCAAGAGAGGGG - Intergenic
1188166351 X:26869579-26869601 GCAGAGCAGCAGCAAGAGACAGG + Intergenic
1188500280 X:30818237-30818259 CTGGAACAGGAGTTAGAGAGAGG - Intergenic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1189048009 X:37613931-37613953 CTGAAGTAGCAGGAAGAAAGGGG - Intronic
1189103419 X:38213805-38213827 CCAGAGCAGGAGCGAGAGAGAGG + Intronic
1189357983 X:40326031-40326053 CTAGAGCAGGAGCAAGAGAGGGG + Intergenic
1189547408 X:42056007-42056029 CAAGAGCAGGAGCAAGAGAAGGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1191041633 X:56087437-56087459 CAGGAGCAGGAACAAGAGAGGGG - Intergenic
1191224678 X:58030917-58030939 CTGAAGTGGCAGTAAGAGAGGGG + Intergenic
1191596017 X:62944932-62944954 CTTTAGCAGCAGCATGAAAGTGG - Intergenic
1191678087 X:63812565-63812587 CTAGAGAAGGAGCAAGAGAGGGG - Intergenic
1192167953 X:68837731-68837753 CTGGAGTAGGAGCAACATAGAGG + Intronic
1192262344 X:69513020-69513042 CTGGAATAGCAACAAGAGAATGG + Intronic
1192706754 X:73534208-73534230 CAAGAGCAGGAGCAAGATAGAGG - Intergenic
1193275362 X:79580157-79580179 CAGGAGCAGGACCGAGAGAGAGG - Intergenic
1193320282 X:80113973-80113995 CTTTATCAGCAGCAAGAAAGTGG + Intergenic
1193475212 X:81955645-81955667 CTGGAGCTGAAGGAAGAGTGGGG + Intergenic
1193802034 X:85947430-85947452 CCAGAGCAGGAGCAAGATAGAGG - Intronic
1194023731 X:88725771-88725793 CCAGAGAAGGAGCAAGAGAGAGG + Intergenic
1194751948 X:97694716-97694738 GTGAAGTGGCAGCAAGAGAGTGG + Intergenic
1194833030 X:98648656-98648678 CAGGAGCAGGACCAAGAGAGAGG - Intergenic
1195215980 X:102702933-102702955 CCGTAGAAGCAGGAAGAGAGTGG + Intergenic
1195477164 X:105300354-105300376 CAGGAGCAGGAGCAAGAGAGAGG + Intronic
1195512427 X:105732467-105732489 CAGGAGTAGGAGGAAGAGAGGGG - Intronic
1195680455 X:107542163-107542185 CTGAGGCAGAAGCAAGAGAAAGG - Intronic
1196153830 X:112405654-112405676 CTGGAGGCGGAGCAAGATAGTGG + Intergenic
1196481736 X:116158157-116158179 CCAGAGCAGGAGAAAGAGAGGGG - Intergenic
1196723540 X:118876422-118876444 CTGGAGCAAGAGGAAGAGAGAGG + Intergenic
1197049807 X:122044902-122044924 CTGGAGAAGGAGGTAGAGAGAGG - Intergenic
1197180050 X:123525133-123525155 CATTAGCAGCAGCAAGAGGGAGG - Intergenic
1197288490 X:124625698-124625720 TGGAAGCAGGAGCAAGAGAGAGG + Intronic
1197667351 X:129238272-129238294 CAGGAGCAAGAGAAAGAGAGTGG + Intergenic
1197835150 X:130686350-130686372 CAGGAGCAGGAACAAGAGAGTGG - Intronic
1197865097 X:131009153-131009175 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
1197881242 X:131169223-131169245 CTGGAGCAGCAGGTAAAGAAAGG + Intergenic
1198083033 X:133257061-133257083 CCGGAGCAGGAGGAAGACAGGGG - Intergenic
1198111370 X:133505331-133505353 CCAGGGCAGAAGCAAGAGAGTGG + Intergenic
1198146401 X:133861757-133861779 CCAGAGCAGGAGCAAGAGAGAGG - Intronic
1198600012 X:138272343-138272365 CCAGAGCAGGAGCAAAAGAGAGG + Intergenic
1198817675 X:140609456-140609478 CTGAAGCAGAAGGAAGAGAGTGG - Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199383104 X:147193447-147193469 CTAGAACAGGAGGAAGAGAGAGG - Intergenic
1199719051 X:150529100-150529122 CTCGAGCAGGAGCAAGAGAGAGG + Intergenic
1200023882 X:153238530-153238552 CTGGAGCTGCGGGAAGAGATGGG - Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201335292 Y:12874171-12874193 CTGGACCAGGAGCAAGAGACTGG + Intergenic