ID: 1014702001

View in Genome Browser
Species Human (GRCh38)
Location 6:124700624-124700646
Sequence CTGGCTAGTAACTGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014702001_1014702006 -1 Left 1014702001 6:124700624-124700646 CCCCCAAAACAGTTACTAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1014702006 6:124700646-124700668 GCTCACTGATTTTAACCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014702001 Original CRISPR CTGGCTAGTAACTGTTTTGG GGG (reversed) Intronic
902069070 1:13717374-13717396 CAGTCTAGGAACTGTTTTGTTGG + Intronic
903893997 1:26590529-26590551 CTGGCATGTAATTTTTTTGGGGG + Intergenic
905112467 1:35605846-35605868 GTGGCTAGTAGTTATTTTGGTGG + Intronic
906462155 1:46042998-46043020 CTGGCAACAAACTGTTTTGTTGG + Exonic
913380720 1:118207557-118207579 CTGGAGAGTGACTGATTTGGGGG + Intergenic
917914765 1:179690213-179690235 ATGGCTGATAACTGGTTTGGGGG + Intronic
919826179 1:201505181-201505203 CTGGCTAGTAACTATTTGCAAGG + Intronic
922883687 1:229001943-229001965 CTTAGTACTAACTGTTTTGGTGG + Intergenic
1063499771 10:6543044-6543066 CTGGGAAGTCACTATTTTGGTGG + Intronic
1067455701 10:46418123-46418145 CTGGCCAGGATCTGATTTGGAGG + Intergenic
1067631503 10:47966516-47966538 CTGGCCAGGATCTGATTTGGAGG - Intergenic
1067796070 10:49323160-49323182 CTGGCTGGTAGCTGTTCTGATGG - Exonic
1075504432 10:123009281-123009303 CTGTCTAGAAGCTGCTTTGGCGG + Intronic
1080205881 11:29728184-29728206 CTGTCTAGTAAATATTTTGTTGG + Intergenic
1080287303 11:30630051-30630073 CTGTCTAGGAATTTTTTTGGGGG + Intergenic
1080801236 11:35612177-35612199 CTGGCTAGTGAATGTTACGGGGG - Intergenic
1085160959 11:74344394-74344416 GTAGTTAGTAACTGTCTTGGTGG - Intronic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1092012523 12:5126656-5126678 CTAGGTAGAAGCTGTTTTGGTGG + Intergenic
1092462804 12:8700635-8700657 CTTGCTGACAACTGTTTTGGGGG + Intronic
1093766330 12:22967472-22967494 CTGACTAGAAACTATTTTTGTGG + Intergenic
1096364598 12:51017981-51018003 ATAGCTAGTATGTGTTTTGGGGG - Intronic
1097102840 12:56601534-56601556 CTGGCTACTTACTGGCTTGGAGG + Exonic
1098302653 12:69069749-69069771 CTGGCTAGAAAGTGTTCTTGTGG - Intergenic
1100268642 12:93002437-93002459 CTTGCCAGTGACTGGTTTGGAGG - Intergenic
1100574154 12:95873795-95873817 TTGGCTTGTAATTGTGTTGGTGG - Intronic
1101769390 12:107734908-107734930 CTAGCTAATGAATGTTTTGGTGG + Intronic
1104573235 12:129943856-129943878 CTTGGTAGGAACTGTTTTGAGGG - Intergenic
1109009364 13:56920705-56920727 GAGGATAGTATCTGTTTTGGGGG + Intergenic
1110415800 13:75250927-75250949 CTGGCTGGGAACTGTGGTGGAGG - Intergenic
1112869887 13:103957392-103957414 CTAGCCAGTAACTATTTTGAAGG - Intergenic
1116880668 14:50165287-50165309 CTGACCAGTTCCTGTTTTGGGGG - Intronic
1121640844 14:95483912-95483934 CTGGCCAGGGACTGCTTTGGAGG + Intergenic
1125199186 15:37084956-37084978 CTGGCAAGTGAATGATTTGGGGG + Intronic
1125641709 15:41236550-41236572 CTGGCCAGGAACTTTTTTGCGGG + Intronic
1127640539 15:60912005-60912027 CTGCCCAGTAACTGATTTGAGGG + Intronic
1128063972 15:64752935-64752957 CTGGCTTGTAACCATGTTGGGGG - Intronic
1128155999 15:65392258-65392280 CTGGCTACAAACTATATTGGCGG - Exonic
1133290699 16:4718751-4718773 TTGGTTAGTGACTGCTTTGGGGG - Intronic
1135044772 16:19146197-19146219 CTGGCTTCTAACAGCTTTGGGGG + Intronic
1139359457 16:66388460-66388482 CTGGACAGTCACTGATTTGGAGG + Intronic
1147037391 17:37691892-37691914 CTGACTAGTTACTGCTCTGGGGG + Intronic
1150214592 17:63459689-63459711 CATGCTAGAAACAGTTTTGGGGG - Intergenic
1151204580 17:72496764-72496786 TTGGATAGGAACCGTTTTGGGGG + Intergenic
1153713376 18:7821765-7821787 CTGGCTACTAAGTGATTTGTGGG + Intronic
1158052485 18:53240265-53240287 CTTGCTATTGACTGTTTTTGTGG - Intronic
1163272663 19:16263519-16263541 CTCGCTGGTTCCTGTTTTGGGGG - Intergenic
926540085 2:14165365-14165387 CTGGATACTCACTGTCTTGGTGG - Intergenic
926907290 2:17817273-17817295 CTGGCAGGTAAGTGTTCTGGTGG - Intergenic
927452847 2:23223753-23223775 CTGGCTATCATCTGTTTTAGGGG - Intergenic
929937046 2:46300509-46300531 CTTGATAGTACCAGTTTTGGTGG + Intronic
929959624 2:46486767-46486789 CTGGCTGGTAACTGCTTAGCTGG - Intergenic
933549428 2:83756624-83756646 CTGGCAAGCAACTGTTTTCATGG + Intergenic
934106327 2:88698360-88698382 CTGTCTTGTACCTGTGTTGGTGG + Intronic
934947920 2:98555302-98555324 TTTGCTAGTAACTCTTCTGGAGG - Intronic
935926219 2:108072599-108072621 CTTGCTAGTAAATATGTTGGTGG - Intergenic
938508382 2:131911635-131911657 CTGGCTAGACACTCTTTTGATGG - Intergenic
947624674 2:231612257-231612279 CTGGTTAGTCAATGTTTTGAAGG + Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170219122 20:13923178-13923200 CTCTCTAATTACTGTTTTGGTGG + Intronic
1172702380 20:36861672-36861694 CTGGCTGGGCACGGTTTTGGAGG - Intronic
1172789166 20:37490678-37490700 CTTGGCAGGAACTGTTTTGGGGG - Intergenic
1174046012 20:47733974-47733996 ATGGCTAATAACTGTTAGGGTGG + Intronic
1174702620 20:52624518-52624540 CAGGCTTGTAACTGCTTTGATGG - Intergenic
1182264567 22:29103911-29103933 CTACCTAGTCACTGTTTGGGGGG - Intronic
1185180959 22:49362871-49362893 CTGGCTGGTACCTGTTACGGGGG - Intergenic
952478578 3:33736310-33736332 CTGGCTACCAGCTATTTTGGGGG - Intergenic
964421381 3:156507225-156507247 CTTGACAGTAACTGTTTAGGTGG - Intronic
970483222 4:16498712-16498734 CTGGCTTGTGGCTGCTTTGGTGG + Intergenic
970687019 4:18580228-18580250 CTGGAGAGAAAGTGTTTTGGGGG + Intergenic
974469848 4:62304168-62304190 CTGGCTTGTAAGTTTTTTGCTGG - Intergenic
976566710 4:86559242-86559264 GTGACTAGCAACTTTTTTGGAGG + Intronic
977840517 4:101697444-101697466 CTGGCTAGCATCTGGTGTGGGGG + Intronic
978314263 4:107418287-107418309 CTGCATGGTAACTGTTTTGCAGG + Intergenic
980623528 4:135342483-135342505 CTGGCCATTATCTGTGTTGGAGG - Intergenic
982271965 4:153599728-153599750 GTGGCTAGTGGCTGTCTTGGAGG - Intronic
982916266 4:161213025-161213047 CTCACCAGCAACTGTTTTGGTGG + Intergenic
983696728 4:170541562-170541584 CTTGCTAGTAACTGGTTTACTGG - Intergenic
985201802 4:187491693-187491715 CTGCCTAGTATGTGCTTTGGTGG - Intergenic
990335431 5:54767872-54767894 CTGGGAAGTAAATATTTTGGGGG - Intergenic
994572148 5:101528884-101528906 GTGGCTGGTACCGGTTTTGGGGG + Intergenic
997805190 5:136910593-136910615 CTGGCTTACAACTGTCTTGGGGG - Intergenic
997856774 5:137379755-137379777 CTGGCTGGTGACTGGTGTGGTGG - Intronic
999428665 5:151507732-151507754 CTTGATAGTTACTTTTTTGGGGG - Intronic
999819426 5:155210728-155210750 ATGCCTAGAACCTGTTTTGGTGG - Intergenic
1002589809 5:180282741-180282763 CTTGCAAGTAACTGTGTTGCTGG - Intronic
1004069582 6:12286693-12286715 CTGTGTAGTATCTGTATTGGGGG + Intergenic
1005147585 6:22708976-22708998 CTGGTTTGTAACTGTGTTTGTGG + Intergenic
1010486913 6:76425787-76425809 CTGGCTAGGCAATGTTTTGATGG + Intergenic
1013389909 6:109674289-109674311 CTGGCAAGTAACTGTTCTATTGG - Intronic
1014257942 6:119182966-119182988 CTGGCTAGAAAGGATTTTGGAGG + Intronic
1014702001 6:124700624-124700646 CTGGCTAGTAACTGTTTTGGGGG - Intronic
1015388255 6:132651024-132651046 TTGGTTAAGAACTGTTTTGGTGG - Intergenic
1015855264 6:137617712-137617734 CTGGCTGGTTTTTGTTTTGGTGG + Intergenic
1015951980 6:138562498-138562520 CTGGCTAGTTTTTGTTGTGGTGG - Intronic
1031497799 7:122472517-122472539 TTGCCTAGAAAGTGTTTTGGAGG - Intronic
1031819966 7:126488219-126488241 ATGACTAATAACTGTTTTGGTGG + Intronic
1032168420 7:129564045-129564067 CTGGCTAATAAGAGTTCTGGGGG - Intergenic
1032277426 7:130471476-130471498 TTGGCTAGTTAATGTTATGGGGG - Intergenic
1043149836 8:76701657-76701679 CTAGCTAGTGACTGTATTTGTGG + Intronic
1047214336 8:122864528-122864550 CTAGCCAGTAACTCTTTTGGTGG - Intronic
1051402730 9:16700604-16700626 CTGGCTTGTAATTTTTTTTGCGG + Intronic
1051756896 9:20411126-20411148 TTGGCTAGTAATTGACTTGGTGG - Intronic
1051895966 9:21989651-21989673 CTGGCTAGGCCTTGTTTTGGAGG - Intronic
1052249439 9:26380185-26380207 CTGGCTACAAACTGTTTTGCAGG - Intergenic
1053052458 9:34973003-34973025 CTGGCTAGTTACTTGTTTGAGGG + Intronic
1055105684 9:72510779-72510801 CTTGCTAGTAAGTCTTATGGGGG - Intergenic
1055763306 9:79633353-79633375 CTGGCTAGTCCCAGTTTTGGAGG - Intronic
1056029234 9:82534372-82534394 CTGGCTAATAACTGTTTCCATGG + Intergenic
1056158063 9:83859396-83859418 ATTTCTAGTAACTGTTTTTGAGG - Intronic
1056352489 9:85764661-85764683 ATTTCTAGTAACTGTTTTCGGGG + Intergenic
1059767684 9:117399261-117399283 TTGGGAAATAACTGTTTTGGGGG + Intronic
1059841013 9:118216466-118216488 CTGTGTAATAAGTGTTTTGGCGG + Intergenic
1188006938 X:25022126-25022148 CTACCTAGTAAGTGTTTTGGTGG - Intergenic
1188620262 X:32212632-32212654 GTGGATTGTCACTGTTTTGGTGG + Intronic
1193730305 X:85095089-85095111 CTGGATAGCAATTGTATTGGCGG + Intronic
1194538556 X:95141104-95141126 ATGGATGGTAACTGTTTTGCTGG + Intergenic
1195643915 X:107207175-107207197 TTGGTTAGGAAATGTTTTGGGGG + Exonic
1197969082 X:132096267-132096289 CTGGCCATGAACTCTTTTGGGGG + Intronic
1199491889 X:148409179-148409201 CAGGAAAGTAAATGTTTTGGAGG - Intergenic