ID: 1014711617

View in Genome Browser
Species Human (GRCh38)
Location 6:124812896-124812918
Sequence TAGAATTAGGAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 10, 3: 99, 4: 541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014711617 Original CRISPR TAGAATTAGGAGAATGAGGA AGG (reversed) Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
901396078 1:8982810-8982832 TAGAAATATGAGCATGAGGCTGG + Intergenic
903195923 1:21688187-21688209 TAGAATTGGGCAAATGAGGCTGG + Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904806783 1:33137773-33137795 CAGAATGATGAGACTGAGGAAGG - Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904955885 1:34283511-34283533 TAAAATAAGGAAAATAAGGAAGG - Intergenic
905078368 1:35294460-35294482 TTGAATTAGAAGAATTATGAAGG + Intronic
905854947 1:41304291-41304313 TAGAATTGGGAGGCTGAGGCGGG + Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906456712 1:46003578-46003600 TCTACTTAGGAGAATGAGGTGGG - Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
908122717 1:61001162-61001184 TAGAATAAGGAGACAAAGGAGGG - Intronic
908380952 1:63596144-63596166 TAGAATCAGGAGAGTAAGCAAGG - Intronic
908608949 1:65834503-65834525 TAGAATTTTAAGAATGAGAAAGG + Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909977095 1:82058063-82058085 AAGAGTTAGGAGAATGATGTTGG + Intergenic
910008765 1:82434173-82434195 GAAAATCAGGAGAAAGAGGAGGG + Intergenic
910020396 1:82582268-82582290 TAGCATTAGTAAAATGAAGAGGG + Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910167739 1:84345479-84345501 TAGAATCAGAAGACTGGGGATGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
910750942 1:90629595-90629617 TAGAATTTTGAGACTGAGCATGG + Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911442855 1:97950482-97950504 TAGAAATAGGATACTGAAGATGG + Intergenic
912509089 1:110176294-110176316 GAGACATGGGAGAATGAGGAGGG + Intronic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913468686 1:119169523-119169545 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
915444736 1:155968130-155968152 TAGAGTTGTGAGGATGAGGAGGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
916090815 1:161306481-161306503 AAGAAGTGGGAGAATGAGCAGGG + Intronic
916456273 1:164973922-164973944 TTGCATTAGGAGAAAGAGCATGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
917506818 1:175634929-175634951 TGCCATTAAGAGAATGAGGAGGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919353954 1:196497354-196497376 TATCATTAGGAAAATTAGGAGGG - Intronic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919491042 1:198205043-198205065 TGGAAGTAGGAGAAGAAGGAAGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920145102 1:203853553-203853575 TATAATCAGGAGGAAGAGGAAGG + Exonic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921021653 1:211241073-211241095 AAGATTTTGGAGAATGAGGAGGG - Intergenic
921480680 1:215661480-215661502 TAGAATTAAGAGAATCAATAAGG - Intronic
921513639 1:216063383-216063405 AAGACTCAGGATAATGAGGAGGG - Intronic
921820198 1:219608452-219608474 TATAATCAGGAGGAAGAGGAAGG - Intergenic
922561347 1:226571948-226571970 GCGAAGTAGGAGAATAAGGAAGG - Intronic
922592404 1:226787191-226787213 TAGATGGAGGACAATGAGGATGG + Intergenic
923493176 1:234502371-234502393 TGGAATTAGAGGAATTAGGAAGG + Intergenic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1064151708 10:12871118-12871140 TTGAACTTGGAAAATGAGGAAGG + Intergenic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065662984 10:28025540-28025562 TAGAATTAGATGAATCACGAAGG - Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1067713179 10:48666523-48666545 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1068791497 10:61035396-61035418 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
1068816325 10:61318945-61318967 TAGAAATAGGAGAGTGGAGAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1070422982 10:76255981-76256003 TAGAATTAGAAGAATGAAACTGG - Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070644451 10:78191990-78192012 TGGAAGTGGGAGAAGGAGGAAGG + Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1071302832 10:84269706-84269728 TAGATTTAGGATCAAGAGGATGG - Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1072910457 10:99496496-99496518 TGGAATCAGTAGACTGAGGAAGG - Intergenic
1073343349 10:102762906-102762928 TAGAATTTAGAGACTGAGGCTGG + Intronic
1073489132 10:103841115-103841137 TAAAAATAGGAGTATGAGGTCGG + Intronic
1073637550 10:105215052-105215074 TAAAAGTAAGAGCATGAGGATGG + Intronic
1074070703 10:110066014-110066036 TAAAATTAGAAGCATGAGAAAGG - Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1075432639 10:122401429-122401451 TGGCAATAGGAGAAGGAGGAAGG + Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076100064 10:127770069-127770091 TTGAATTAGTAGACTGAGTAAGG + Intergenic
1076503959 10:130959534-130959556 TAGATTTAGGGGATTGAGGGAGG - Intergenic
1077392436 11:2306410-2306432 TAGAATGAGGAGAAAGAAAATGG + Intronic
1077475424 11:2788069-2788091 TAGAATGTGGTGAATGTGGATGG + Intronic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1078135039 11:8644778-8644800 TAGAATGAGGAGACTGAGGATGG - Intronic
1078335320 11:10458653-10458675 CAGAATTATGATTATGAGGATGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078567573 11:12430046-12430068 TAGACTTAAGAAAATGATGAAGG - Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080665323 11:34330913-34330935 AAGAAGTTGGAGAATCAGGAAGG - Intronic
1081189449 11:40084828-40084850 TAGATTTAGTAGTATGAGAATGG - Intergenic
1081194419 11:40143702-40143724 GAGAATTATGAGAACAAGGATGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081535207 11:43991398-43991420 TAGAATGAGAACAGTGAGGATGG + Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1083152282 11:60799306-60799328 TGAAATTAGGAAAATGAGGAAGG - Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084931452 11:72559815-72559837 TGGAGTTAGGAGGCTGAGGAGGG + Intergenic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086578586 11:88369839-88369861 TAGACTCAGGAGAAAGAGGTTGG - Intergenic
1086597397 11:88589734-88589756 TAGACATAGGAGCATGAGGAGGG - Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088194805 11:107262559-107262581 GAGACTTAGGGGATTGAGGATGG + Intergenic
1089028601 11:115298364-115298386 TAGAATGAGGAGAAGAAGAAAGG + Intronic
1089098220 11:115937642-115937664 GAGACTGAGGAAAATGAGGATGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089924303 11:122241448-122241470 AGAAATTAGGAGAATGAAGATGG + Intergenic
1089933887 11:122343524-122343546 TAGAATCAGGGGACAGAGGAGGG + Intergenic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090330132 11:125924859-125924881 TAGGATAAGGAGAACCAGGATGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091947023 12:4555738-4555760 TAGAAGGAGGTGAGTGAGGATGG - Intronic
1092314623 12:7397474-7397496 TAGAATTCTGAAAATTAGGATGG + Intronic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1092867777 12:12779108-12779130 AAAAATTAGGAGAGAGAGGAGGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093770808 12:23015511-23015533 GAGATTTAGGAGACTGAGGCAGG - Intergenic
1093957237 12:25235068-25235090 TGGAATTGGCAGAATGAAGATGG - Intronic
1094044453 12:26152089-26152111 TAGAATGAAGAAAATGATGAGGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095139070 12:38640298-38640320 TAGAATTAGGATAAGGAAAAAGG + Intergenic
1095424369 12:42059788-42059810 TTGAATCAGTAGAATGAGTAAGG + Intergenic
1095610009 12:44116775-44116797 TAGAATTTGTAGGATGAGGATGG - Intronic
1095724960 12:45441582-45441604 TATATATAGGAGAATGAGGTTGG + Intergenic
1096000305 12:48124195-48124217 TAGAATGAAGAAACTGAGGAAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096591448 12:52662579-52662601 GGGAATTAGGTGAATGAGGGTGG - Intergenic
1096792144 12:54051981-54052003 TGCAATTAAGGGAATGAGGAGGG - Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097376930 12:58853527-58853549 TAGAATTCGGAGAAGGAAAAAGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097973511 12:65660556-65660578 AAGACTTGGGAGAATTAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098502710 12:71212153-71212175 TGGAATTTGGAGACTCAGGATGG + Intronic
1098622175 12:72614984-72615006 TATAAATTGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099403401 12:82228308-82228330 TATACTTAGGAAAATAAGGAAGG + Intronic
1099585765 12:84510363-84510385 TTGAAATAGGAGAAAGAAGAGGG - Intergenic
1100019774 12:90055306-90055328 TAGACTCATGAGATTGAGGAGGG + Intergenic
1100535889 12:95508660-95508682 TAGAATTAGGAGAAAATGAAAGG - Intronic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1100806429 12:98289650-98289672 TAGAAATATTACAATGAGGAGGG + Intergenic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101282803 12:103276843-103276865 TAGAAGGAGGATGATGAGGAGGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1101711497 12:107271202-107271224 TAGAATTAGGAGAGTGGGGAGGG - Intergenic
1101946746 12:109143163-109143185 TAGAATGAGGAGGCTGAGGCTGG + Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1104525543 12:129517276-129517298 TAGCATTAGGAGAATCAAGTTGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105743848 13:23357833-23357855 TAAAAAGAGTAGAATGAGGAAGG + Intronic
1106207987 13:27617252-27617274 TAGAATTAGAAGACTGGGGCAGG - Intronic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106688266 13:32085666-32085688 TCCAATGAGGATAATGAGGAGGG - Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1108411582 13:50153815-50153837 TAGGATTAAGAGGATGGGGAGGG + Intronic
1108449238 13:50544160-50544182 TAGAATCAGGAGAACTTGGATGG + Intronic
1108877000 13:55059821-55059843 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1111037126 13:82690494-82690516 AAGAATTAGGTAAATGATGATGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111806290 13:93043292-93043314 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1112163458 13:96893081-96893103 TAGAATTGAGTGACTGAGGAAGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114119784 14:19658522-19658544 TAAAATTAGTAGAATGAGACAGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114684398 14:24514272-24514294 TAGAAGTAGAAGAAAGGGGATGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118411129 14:65479565-65479587 TGGAAGTAGGAGAAGGAGAAAGG - Intronic
1118594454 14:67424947-67424969 AAGAATTAAGACAATGAGAAGGG - Intergenic
1119594366 14:75920362-75920384 TAGCATTAGGAGAAATATGATGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120315296 14:82885210-82885232 TAGAATAAGTAGAATCAGTACGG + Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120590495 14:86368371-86368393 TTGAATTAGTAGAATGAATAAGG - Intergenic
1120907114 14:89630381-89630403 TAGAATTTGGTGAATGAGGGTGG - Intronic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1121808596 14:96857252-96857274 TAGAATTAGGGGGATGGGGATGG + Intronic
1122612633 14:102996050-102996072 GCCAATTAAGAGAATGAGGATGG + Intronic
1125084977 15:35719329-35719351 TAGATTTAGTAGAAAGAAGAAGG - Intergenic
1125151405 15:36536532-36536554 TAGAAATAGGGAAATGAGAAAGG - Intergenic
1125398577 15:39275769-39275791 TAAAATTATGAGAATGATTAAGG - Intergenic
1126232619 15:46344593-46344615 TAAAAGGAGAAGAATGAGGAAGG + Intergenic
1126813546 15:52432733-52432755 AAGAATTAGGCCAATTAGGAGGG - Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127910714 15:63413844-63413866 TATCAGTAGGAAAATGAGGATGG + Intergenic
1129285186 15:74518814-74518836 TACAACTAGTAGAATAAGGAAGG + Intergenic
1129445546 15:75615342-75615364 TAGAGTTGGGAGAAGGAGTATGG - Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130542567 15:84832160-84832182 TGGAACTGGGAGAAAGAGGAAGG - Intronic
1130894959 15:88162839-88162861 TGGAAGTCTGAGAATGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131420505 15:92300950-92300972 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1133326090 16:4943262-4943284 TAGAATTAGCAGATTTAGGGAGG + Intronic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1138336220 16:56255199-56255221 TAGATTTAGGAGAAAAGGGAGGG + Intronic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139738866 16:69017590-69017612 GAGATTTAGGAGACTGGGGAAGG - Intronic
1141254307 16:82386489-82386511 TAGAAGTAGGAAACTAAGGAGGG - Intergenic
1143391289 17:6560774-6560796 GAGAAGGAGGAGAATGAGAAAGG - Intergenic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1146118713 17:30169148-30169170 TAGAATAAGCAGACTGAGAAAGG - Intronic
1146997374 17:37333137-37333159 TAGAATTAGGAGCAGGAAAAAGG + Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148826920 17:50400631-50400653 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149355537 17:55835426-55835448 TAGAAATCAGAAAATGAGGAAGG - Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150588036 17:66535967-66535989 AATAATCAGGAGAATAAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151119434 17:71775984-71776006 TAGAATGAGGAAAATTAAGATGG + Intergenic
1153019197 18:611395-611417 TAGAATTAAAAGGATTAGGAGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1156088243 18:33434835-33434857 TAGATGTAGGAGAAGGAAGAGGG + Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1158710517 18:59833345-59833367 TAGAATTAAGAAAAAGAGAAAGG - Intergenic
1158713786 18:59860366-59860388 TAGAATTAGGAGGCCGAGCATGG + Intergenic
1158786001 18:60712473-60712495 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1159565502 18:70043390-70043412 CAATATTAGGAGAATGAGAAGGG + Intronic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159718149 18:71850701-71850723 TAGAAGTAGGATATTAAGGAAGG - Intergenic
1159787587 18:72732727-72732749 TAAAATTATGAAAATGAGAAAGG - Intergenic
1159893036 18:73970851-73970873 TACAGTTAGGAGAATGAGAAAGG - Intergenic
1160060680 18:75526495-75526517 TAGAATTAGCAGAAACACGACGG + Intergenic
1160060702 18:75526606-75526628 TAGAATTAGCAGAAACACGATGG + Intergenic
1160819824 19:1052644-1052666 GAGAAGTAGGAGGAAGAGGAGGG + Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164129860 19:22351563-22351585 TAGAATTAGGGGAATAGGTAAGG + Intergenic
1164169688 19:22714446-22714468 TAGAATTAGGGGAATAGGTAAGG - Intergenic
1164323041 19:24167813-24167835 TAGAATTAGGAGAATGAAAAAGG - Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1165716014 19:38046361-38046383 AAGAAATAGGGAAATGAGGAGGG - Intronic
1166165863 19:40987927-40987949 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1167764158 19:51469129-51469151 TGGAGATAGGAGAATGAGCAAGG + Intergenic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
1168165933 19:54547863-54547885 TAGACTCAGGAGACTGAGGCAGG - Intergenic
926003942 2:9357046-9357068 TAGAATTAGAGGAATGAAAAGGG - Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927291358 2:21408137-21408159 TAGAACTAGGAGAATGTGCTGGG - Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928750243 2:34462111-34462133 TAGACTTTAGAGCATGAGGAAGG - Intergenic
929168115 2:38904203-38904225 TAGACTTTGGAGAATGAGTAAGG + Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930759035 2:55011733-55011755 TAAAATTAGGAAAATGAGAGGGG + Intronic
931735560 2:65190230-65190252 TAGATTAAAGAAAATGAGGACGG - Intergenic
932148143 2:69342885-69342907 AAGCATTAGGGGAATGGGGACGG - Intronic
932917998 2:75877812-75877834 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933367372 2:81370621-81370643 TACAATCATGAGAATGAGGATGG - Intergenic
933374480 2:81461905-81461927 TGGAGTTAGGAGGATTAGGAGGG - Intergenic
933611770 2:84444075-84444097 TGGAATTATGAGAGTTAGGAGGG - Intronic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935057191 2:99577839-99577861 TAGAATTGGGTGAAGGATGATGG + Intronic
935248154 2:101237246-101237268 TAGAAATAGGAAAAAGAAGAAGG + Intronic
935295783 2:101648116-101648138 TAGAATTAGGAAAATAAGGATGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936679232 2:114751742-114751764 TACAATTTGGAGAGTGAGGCTGG - Intronic
936707443 2:115091113-115091135 TGGATATAAGAGAATGAGGAGGG - Intronic
937510624 2:122591076-122591098 TAGAATTGAGAGAATTAGAATGG + Intergenic
938232938 2:129677623-129677645 TGGAGGTAGGAGAATGAGGGTGG - Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
938880483 2:135581313-135581335 TGGAATTATGAGTATAAGGAAGG - Intronic
938887565 2:135668120-135668142 TTGGATTAGGAGAATGATGTGGG + Intronic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942585464 2:177470860-177470882 TATAAGTAGTAGAATCAGGATGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
943011811 2:182459422-182459444 TTGATTTAGGAGAATAAGAAAGG - Intronic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944203944 2:197137311-197137333 TAGCCTTAGGATGATGAGGAAGG + Intronic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944790910 2:203125108-203125130 TAAAATTTGGAAAATGAAGATGG + Intronic
944813050 2:203346748-203346770 GAGAAATAGGAGAAAGAGCAGGG + Intronic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945190523 2:207182864-207182886 CACACTTAGGGGAATGAGGAGGG + Intergenic
947188531 2:227476699-227476721 TACAATTAGTAGCATTAGGATGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948106288 2:235416860-235416882 AAGTATTAGGAGAAAGAGAAAGG - Intergenic
948580197 2:238981894-238981916 TAGGATTAGGAAAAGGAGAAAGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169050486 20:2572791-2572813 AAGAATTAAGTGAATGAGAATGG - Intronic
1169581916 20:7033074-7033096 TTAAATTAAGAGAATGATGAAGG + Intergenic
1169730032 20:8776867-8776889 CAGAAATGGGAGAATAAGGAGGG + Intronic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1170127024 20:12975231-12975253 TAGAAGGAGGAAACTGAGGAGGG - Intergenic
1170145308 20:13167155-13167177 TAGAATAAGGTTAATTAGGAGGG + Exonic
1173108307 20:40159610-40159632 AAGAATTAGTAGAATGTGAAAGG + Intergenic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1174741164 20:53015519-53015541 TAGAATTTGCACAATGAGGATGG + Intronic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1177011222 21:15731774-15731796 TAGAATAGGGAGGATTAGGAAGG - Intronic
1177060110 21:16361851-16361873 TAGAATTAAGAATATGAGGCCGG - Intergenic
1177657622 21:24039660-24039682 TAGAAATAGGAAAAGGAGAATGG - Intergenic
1177914750 21:27074978-27075000 TTGAATTAGCAGACTGAGTAAGG - Intergenic
1178191992 21:30293924-30293946 TATAGTTGTGAGAATGAGGAAGG - Intergenic
1178982134 21:37273547-37273569 GAGAAAGAGGAGGATGAGGAGGG + Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1180462961 22:15583563-15583585 TAAAATTAGTAGAATGAGACAGG + Intergenic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184264463 22:43339706-43339728 TAGAATGAGGAGAGTGGGGGAGG - Intronic
1184264489 22:43339800-43339822 TAGAATGAGGAGAGTGGGGGAGG - Intronic
949372054 3:3346065-3346087 TAGACTGTGGAGAATGAGAAAGG + Intergenic
949547544 3:5084677-5084699 AAGAGTTAGGAAAAAGAGGAGGG - Intergenic
949793715 3:7823101-7823123 TAGGATTGGTAGAATGAAGATGG - Intergenic
951355250 3:21659208-21659230 TATAATGAAGAGTATGAGGAGGG - Intronic
951392284 3:22121175-22121197 TAGAAGTAAGTGAAAGAGGAAGG - Intronic
951412068 3:22377902-22377924 TAGAGTTTGGATACTGAGGAGGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951596811 3:24327270-24327292 TAGAAGTGAGAGAATGAGGGTGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952916820 3:38252680-38252702 TACAAATAGGAGACTGACGAAGG - Intronic
952921892 3:38291082-38291104 TAAAATTAGGAGAAGGAAAAAGG - Intronic
953213980 3:40900781-40900803 TAGCATGAGGAGAGTGAGGTAGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955498022 3:59556512-59556534 TAAAAATAGGAGAGGGAGGAGGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957737727 3:84224642-84224664 GACAATTAGAAGAGTGAGGATGG + Intergenic
957847705 3:85759881-85759903 TAGAATTTGGAGAAAGTGTATGG - Intronic
959086050 3:101851688-101851710 TAGAACTATGAGAGTCAGGATGG + Intronic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960141690 3:114157398-114157420 TAGACTTTGGAGCATGAGAAGGG - Intronic
960262815 3:115587956-115587978 CATCATTAGGAGAATGAGCAGGG - Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961104269 3:124227904-124227926 TGGGATTGGGAGACTGAGGATGG + Intronic
961179707 3:124867063-124867085 TGGAGGTAGGAGCATGAGGAGGG - Intronic
961233961 3:125347677-125347699 TAAAATTAGGAGGCTGAGGCAGG - Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963462752 3:145637819-145637841 GAGAATGATGAGAATGATGAAGG - Intergenic
963754532 3:149220130-149220152 TAGAATTTGGTGAATGGGGGCGG - Intronic
963809150 3:149757695-149757717 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964068875 3:152608220-152608242 TAGAATTAGAATAATGAGCCGGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967640115 3:191852555-191852577 TTGAATTAGTAGACTGAGTAAGG + Intergenic
968261525 3:197328667-197328689 TCGAATTAGGAGAATGGAGCAGG + Intergenic
968329288 3:197851415-197851437 TAGAAAGAGGAAAATGAAGAAGG + Intronic
968359941 3:198139733-198139755 GAGAAGGAGGAGAATAAGGAGGG + Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968532797 4:1103808-1103830 TGAAATTAGGAAAATGACGAGGG + Intronic
969645292 4:8424979-8425001 TAAAATTAGGAGAAGGAAAAAGG + Intronic
970164015 4:13217127-13217149 TACAAGGAGGAGATTGAGGATGG + Intergenic
970331544 4:14990867-14990889 GAGAAATCAGAGAATGAGGATGG + Intergenic
970648645 4:18152739-18152761 TAAACTCAGGAGAATGAGGCAGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
971980173 4:33741638-33741660 TAGAATTAGGAGAAAGGAAAAGG + Intergenic
972179176 4:36442919-36442941 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
972471256 4:39406851-39406873 TTGAACTGGGAGACTGAGGATGG - Exonic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
973143043 4:46792712-46792734 GAGAATCAGAAGAATTAGGATGG - Intronic
973333969 4:48937331-48937353 TAGAAGTTGAGGAATGAGGATGG - Intergenic
974107521 4:57487040-57487062 TATAATTCAGAGAATGAGGTGGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974335524 4:60539539-60539561 CAGAATTAAGAGACTCAGGAAGG + Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976893400 4:90078388-90078410 TAGAATGAGGAAATTGAAGATGG + Intergenic
977232141 4:94464443-94464465 TAGAATTAAGAGATTTAGTAAGG + Intronic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978708400 4:111746074-111746096 TAAAAATAGAAGAAAGAGGAAGG - Intergenic
978850084 4:113324654-113324676 TAGAATTTGGAGAATTAGGAAGG + Intronic
978909890 4:114050573-114050595 TAGAATTAGGATAAGGAAAAAGG + Intergenic
979341562 4:119530579-119530601 TACAATTAGGAAAAAGAGGTGGG - Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
980135120 4:128851264-128851286 TAGAAGTAAGAGGATGAGGAGGG + Intronic
980146627 4:128993638-128993660 TAGAATTAGGAGACTCGAGAAGG + Intronic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
980831578 4:138134783-138134805 TAGAATTATAAAAGTGAGGAAGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981259370 4:142701341-142701363 TATAGCCAGGAGAATGAGGAAGG + Intronic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982461103 4:155669454-155669476 TGTCATTCGGAGAATGAGGAAGG + Intronic
983666700 4:170191450-170191472 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
984080915 4:175249025-175249047 TAGATTGAGGACAATGAGAAGGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985148384 4:186919152-186919174 TGGAAGTACGGGAATGAGGATGG + Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986057321 5:4151264-4151286 TAAAATCAGGAGAATTAGAAGGG + Intergenic
986599071 5:9453032-9453054 TAGACTTAGGATAATGAAGCAGG - Intronic
987778557 5:22401300-22401322 TAAATTTTAGAGAATGAGGAAGG - Intronic
988285858 5:29214895-29214917 TAGAGTTAGGAGCTTCAGGAGGG - Intergenic
988456978 5:31395302-31395324 TAGAATTGGGAGAAGGAAAAAGG - Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
992457319 5:76927712-76927734 TAGAAAGAGGAGAGTTAGGAAGG + Intergenic
993236514 5:85317214-85317236 TATAATTAGGAAAATGGTGAGGG - Intergenic
993400717 5:87447103-87447125 TAGATTTAAGAGAATTAAGAGGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994500883 5:100575968-100575990 TAGAATTTGGAAAATGAAGAGGG - Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995962574 5:117860845-117860867 TAGGAGTAGGAGAATTAGAATGG + Intergenic
996432737 5:123399904-123399926 TAGTATGAGGAGACTGAAGAGGG + Intronic
996531049 5:124527386-124527408 AAGAATTTTGAGAATGAGGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997760376 5:136442162-136442184 TAGAATTAGGAAAAGGACAAAGG - Intergenic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
999071647 5:148749761-148749783 TAGAACTAGTAGAAAGAGAAAGG + Intergenic
1000401751 5:160836085-160836107 TAGATTCAAAAGAATGAGGAGGG + Intronic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001243325 5:170086778-170086800 TAGAAACAGGAGACTGAGGTAGG - Intergenic
1001747896 5:174105997-174106019 TACAACTGGGAAAATGAGGAAGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003637011 6:7841612-7841634 TATGATGAGGAGAGTGAGGAAGG + Intronic
1003939841 6:11013746-11013768 TAGAATTGGGTGGATGAGAAGGG + Intronic
1004142229 6:13028901-13028923 TTGGATTAGTAGATTGAGGAAGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1005323330 6:24676975-24676997 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008042420 6:46816251-46816273 TAAAAATAGAAGAATGAGGCCGG - Intronic
1008310763 6:49970207-49970229 TACAGTTGAGAGAATGAGGAGGG - Intergenic
1008581993 6:52915904-52915926 TAGCATTAGAAGAAGGAGAAAGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009545115 6:65010716-65010738 TAAAATTAGGAGAAGGAAAAAGG + Intronic
1009565435 6:65306110-65306132 TATAATCAGGAGGAAGAGGAAGG + Intronic
1010797150 6:80130514-80130536 TAGAAGTAGGAGAAAGCAGACGG - Intronic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011189452 6:84714481-84714503 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1011457900 6:87571579-87571601 TAGAATTGGGAAAAAGAGAAGGG + Intronic
1011539526 6:88415412-88415434 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1011992011 6:93533393-93533415 ATGAATTAGGAGAATGAACATGG - Intergenic
1012680102 6:102169312-102169334 TAGGGTTAGGGGAAAGAGGAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013634553 6:112016644-112016666 TGGAAATAGGCGAATGAGAAAGG - Intergenic
1013854931 6:114560868-114560890 TAATATTAGGGGAATGAGGCTGG - Intergenic
1014091809 6:117412420-117412442 TAGAACTTGGAAAATGACGATGG - Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1015951868 6:138561476-138561498 TAGGATTAGTGGAATGAAGAGGG - Intronic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016492362 6:144620753-144620775 TATTACTATGAGAATGAGGAGGG + Intronic
1016818138 6:148322703-148322725 TAGAAGTAGGAGAATTATCATGG - Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1018621268 6:165731526-165731548 TAGAAAGAGAAGAGTGAGGAAGG + Intronic
1018761380 6:166897005-166897027 TAGAATTGGGAGAAGGAAAAAGG + Intronic
1019398432 7:836205-836227 AAGATGTAGGAGAACGAGGAAGG + Intronic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020983631 7:15104477-15104499 AAGAATTAGGCAATTGAGGAGGG - Intergenic
1022861616 7:34373244-34373266 TAGAATTGTAATAATGAGGAAGG + Intergenic
1022924111 7:35043016-35043038 TGGAACTAGGAGAATGTAGAAGG - Intergenic
1023132503 7:37016785-37016807 TATAAATAGGAGATTGAGAAAGG + Intronic
1023439194 7:40169141-40169163 TATAATTAGGAGAAGGAAAAAGG - Intronic
1024695947 7:51856908-51856930 TGGAATTAGGATAATTATGAAGG + Intergenic
1024828897 7:53425164-53425186 TATAATTTGGTGTATGAGGAAGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025781933 7:64609545-64609567 TAGGCTTAGGAAAATGAGTAAGG + Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026616904 7:71913233-71913255 TAGAATTTGGAAATTGATGAAGG - Intronic
1027362739 7:77426393-77426415 TAGATTTTTGAGAATGAAGAGGG - Intergenic
1027392796 7:77722366-77722388 TGGGATTATGAGAATGAGGGAGG + Intronic
1028309363 7:89311147-89311169 TAGAGTTAAGAGAATCAGTAAGG - Intronic
1028588247 7:92471887-92471909 TAGAATTAGGAGAAGAAAAAAGG - Intronic
1028712759 7:93928645-93928667 TAGAATTAGAAAAATCAGGCCGG + Intergenic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1029909482 7:104130246-104130268 TAGAATTTGGAGATAGAGTATGG - Intronic
1029987272 7:104933897-104933919 TACCATTAAGAGAATGAGGCAGG - Intergenic
1030169602 7:106588247-106588269 TAGAAGTTTGAGAAAGAGGATGG - Intergenic
1030266932 7:107630614-107630636 AAGAGATAGGAGACTGAGGAAGG + Intergenic
1030324191 7:108202795-108202817 AAGAACTAAGAGAATGAGAATGG - Intronic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1030662003 7:112229912-112229934 TAGAATGAGGTGCTTGAGGAAGG + Intronic
1030800441 7:113843687-113843709 TAGACTTAGGGGTTTGAGGAAGG - Intergenic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1031264893 7:119569589-119569611 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1031471640 7:122174758-122174780 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1031686548 7:124737028-124737050 ATGAATTAGGTGAATTAGGATGG - Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032500673 7:132397446-132397468 AAGAATTGGGGGAATGAGGTAGG + Intronic
1032714302 7:134491750-134491772 TAGTATGAGGTGAATGAGAAAGG - Intergenic
1032725941 7:134590205-134590227 TAGAATTAGGAGAAGAAAAAAGG + Intergenic
1032957605 7:136989611-136989633 TTGAATTTGGAGAATGAGGGAGG - Intronic
1033036169 7:137878345-137878367 TAGCATTTGGGCAATGAGGAAGG - Exonic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1035519973 8:267438-267460 TAGAAATAGAAGAGTGGGGAAGG + Intergenic
1037085129 8:14838903-14838925 TAGAAGTAGGAGACTCAGAAAGG + Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037706047 8:21316100-21316122 TAGAACTAGGACTTTGAGGAAGG - Intergenic
1038076717 8:24084109-24084131 TAGACTTAGTAGCATGAGGATGG - Intergenic
1038878258 8:31576595-31576617 TTGAATTTGGACAATGAGGGAGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039177306 8:34824453-34824475 TGGAATTTGGAAAAGGAGGATGG - Intergenic
1039180694 8:34862644-34862666 TAGGATTATGAGACTGAAGAAGG + Intergenic
1040029152 8:42808585-42808607 AAGAATCAGGAGTTTGAGGATGG - Intergenic
1040070414 8:43182553-43182575 GCTAATTAGGAGACTGAGGAGGG - Intronic
1040527421 8:48237168-48237190 TAGAATTAGGAGAATGAAAATGG - Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041760846 8:61364588-61364610 TAGAATTTGTAAAATGAGAAAGG + Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042361855 8:67892501-67892523 TAGATTTTGGAGGGTGAGGAGGG - Intergenic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1043128827 8:76435178-76435200 TACAATTTGGAAAGTGAGGAGGG - Intergenic
1043334806 8:79162087-79162109 TAGAATCAGGAATATGTGGATGG + Intergenic
1043499207 8:80836444-80836466 TAGAATATGGGGAATGAGGAGGG - Intronic
1043606013 8:82000779-82000801 CAGAATTATTAGAATGATGAAGG - Intergenic
1043665354 8:82803950-82803972 GAGAATTAGGGGATTGAGAATGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1044194922 8:89364042-89364064 TAGAATTGGGAAAAGTAGGATGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046626445 8:116581551-116581573 TAAAACTAGGAGAATGAGGAAGG - Intergenic
1046797360 8:118387464-118387486 TACAATTATGAGGAGGAGGAGGG - Intronic
1048004492 8:130408287-130408309 TTGAATCAGGAGACTGAGTAAGG + Intronic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1052242830 9:26295121-26295143 TAAATTTTGGAGAATGAGGAAGG - Intergenic
1052528884 9:29656495-29656517 TACAATTAGGAGAAGGAAAAAGG - Intergenic
1052889128 9:33680793-33680815 TAAAAGTAGAAGAATGTGGAAGG + Intergenic
1053134529 9:35641973-35641995 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1054952992 9:70873877-70873899 TAAAAATAGGAGAAGGAAGAAGG - Intronic
1055218458 9:73897231-73897253 GAGGATGAGGAGAATTAGGAAGG - Intergenic
1055634239 9:78259300-78259322 GATCATTAGGAAAATGAGGACGG + Intronic
1055668372 9:78574856-78574878 AAGACTTAGGATAATTAGGAAGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057570787 9:96202868-96202890 TGGATTGAGGAGAATGAGAAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059961642 9:119570759-119570781 TAGAATTTGGACAAGGAGAATGG + Intergenic
1059997196 9:119923212-119923234 TAGTATCATGAGAATGAGGATGG + Intergenic
1060950499 9:127599128-127599150 TAGAATTTGCAGGTTGAGGAGGG - Intergenic
1062195472 9:135271144-135271166 AAGGTTTAGGAGAATCAGGAGGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1186139783 X:6559420-6559442 TAGAATAAGGAGAGTGTGAAGGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187082723 X:16007979-16008001 CTAAATTTGGAGAATGAGGAAGG + Intergenic
1187363584 X:18649344-18649366 GAAAACTAGGAGAATGAGGTGGG - Intronic
1187406924 X:19012807-19012829 TAGAATTTGGAGGATGGGGGAGG - Intronic
1187600588 X:20825018-20825040 TGGAATTAGCAGAATTGGGAAGG - Intergenic
1187833528 X:23407161-23407183 TAGAATTAGAAAATTGACGAAGG + Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189953275 X:46253794-46253816 TAGAAATAGCAGAGTAAGGATGG + Intergenic
1191166717 X:57399814-57399836 TAGAATTAGGAGAAAGGAAAAGG - Intronic
1191924873 X:66298305-66298327 TAGAATTAGGAGAACGAAAAAGG - Intergenic
1192121977 X:68464878-68464900 AAGAAATATGAGAGTGAGGAGGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1194097494 X:89660518-89660540 TAGAAATAATACAATGAGGAGGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195433250 X:104812966-104812988 AAGAATTAGCAAAATGAGCAAGG + Intronic
1195762792 X:108264881-108264903 TAGAATTAAGGGAAAGAGCATGG + Intronic
1196906372 X:120440677-120440699 TAAAATTAGGGGAATAATGAAGG + Intronic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197576799 X:128222979-128223001 TTGAATTAGAAGAATCAGGTAGG + Intergenic
1197664839 X:129212410-129212432 AAGAATTATGAGGAAGAGGAAGG + Intergenic
1197842645 X:130765488-130765510 TAAAATTAGGTGAAAAAGGAAGG - Intronic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199406494 X:147467783-147467805 TAGAATTTGGTGTCTGAGGAGGG - Intergenic
1200450514 Y:3321892-3321914 TAGAAATAATACAATGAGGAGGG - Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic
1201905947 Y:19085828-19085850 TAGAATTAGGAAAATGAAAAGGG + Intergenic