ID: 1014715006

View in Genome Browser
Species Human (GRCh38)
Location 6:124853834-124853856
Sequence CAGCTGTGCTAGAGGAAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014715006_1014715010 18 Left 1014715006 6:124853834-124853856 CCGCCTTTCCTCTAGCACAGCTG No data
Right 1014715010 6:124853875-124853897 TAGTATATAAAAGTGTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014715006 Original CRISPR CAGCTGTGCTAGAGGAAAGG CGG (reversed) Intergenic
No off target data available for this crispr