ID: 1014715486

View in Genome Browser
Species Human (GRCh38)
Location 6:124860380-124860402
Sequence AAACTCTTGATATGATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014715485_1014715486 16 Left 1014715485 6:124860341-124860363 CCACTATATACTTATTGGATGAA No data
Right 1014715486 6:124860380-124860402 AAACTCTTGATATGATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014715486 Original CRISPR AAACTCTTGATATGATAGAG AGG Intergenic
No off target data available for this crispr