ID: 1014717787

View in Genome Browser
Species Human (GRCh38)
Location 6:124886372-124886394
Sequence GAACCTTCTGGACCTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014717787_1014717791 1 Left 1014717787 6:124886372-124886394 CCTCAGGGAGGTCCAGAAGGTTC No data
Right 1014717791 6:124886396-124886418 CAAGGAGGTGAAATTAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014717787 Original CRISPR GAACCTTCTGGACCTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr