ID: 1014724825

View in Genome Browser
Species Human (GRCh38)
Location 6:124962160-124962182
Sequence CGGTGATGGCGCGGGACTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014724814_1014724825 6 Left 1014724814 6:124962131-124962153 CCTCGGGCCGCGCGTCCGGCAGC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724804_1014724825 28 Left 1014724804 6:124962109-124962131 CCCTCGACCCTTTGACCACCGCC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724809_1014724825 20 Left 1014724809 6:124962117-124962139 CCTTTGACCACCGCCCTCGGGCC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724803_1014724825 29 Left 1014724803 6:124962108-124962130 CCCCTCGACCCTTTGACCACCGC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724810_1014724825 13 Left 1014724810 6:124962124-124962146 CCACCGCCCTCGGGCCGCGCGTC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724811_1014724825 10 Left 1014724811 6:124962127-124962149 CCGCCCTCGGGCCGCGCGTCCGG No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724819_1014724825 -9 Left 1014724819 6:124962146-124962168 CCGGCAGCCGGGACCGGTGATGG No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724805_1014724825 27 Left 1014724805 6:124962110-124962132 CCTCGACCCTTTGACCACCGCCC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724808_1014724825 21 Left 1014724808 6:124962116-124962138 CCCTTTGACCACCGCCCTCGGGC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724813_1014724825 7 Left 1014724813 6:124962130-124962152 CCCTCGGGCCGCGCGTCCGGCAG No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data
1014724817_1014724825 -1 Left 1014724817 6:124962138-124962160 CCGCGCGTCCGGCAGCCGGGACC No data
Right 1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014724825 Original CRISPR CGGTGATGGCGCGGGACTGA CGG Intergenic
No off target data available for this crispr