ID: 1014725198

View in Genome Browser
Species Human (GRCh38)
Location 6:124963680-124963702
Sequence CTGTATAAGAAATAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 387}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014725198_1014725204 12 Left 1014725198 6:124963680-124963702 CCCTCCTCTTATTTCTTATACAG 0: 1
1: 0
2: 1
3: 27
4: 387
Right 1014725204 6:124963715-124963737 AAGCTTGCTCAAAGGAGGAGAGG 0: 1
1: 0
2: 1
3: 26
4: 217
1014725198_1014725203 7 Left 1014725198 6:124963680-124963702 CCCTCCTCTTATTTCTTATACAG 0: 1
1: 0
2: 1
3: 27
4: 387
Right 1014725203 6:124963710-124963732 AGCACAAGCTTGCTCAAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 113
1014725198_1014725202 4 Left 1014725198 6:124963680-124963702 CCCTCCTCTTATTTCTTATACAG 0: 1
1: 0
2: 1
3: 27
4: 387
Right 1014725202 6:124963707-124963729 GCAAGCACAAGCTTGCTCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 110
1014725198_1014725205 30 Left 1014725198 6:124963680-124963702 CCCTCCTCTTATTTCTTATACAG 0: 1
1: 0
2: 1
3: 27
4: 387
Right 1014725205 6:124963733-124963755 AGAGGAAGAGACTGCCTCATCGG 0: 1
1: 0
2: 3
3: 24
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014725198 Original CRISPR CTGTATAAGAAATAAGAGGA GGG (reversed) Intronic
901160052 1:7170083-7170105 CTGCTTAAGAAATTAGAAGAAGG - Intronic
903351822 1:22721619-22721641 CTGTCTAAGAAAAAAGAGAGAGG - Intronic
903600193 1:24532526-24532548 CTGCATAAAAAATAAATGGATGG - Intronic
903764229 1:25723350-25723372 CTGGAAGTGAAATAAGAGGAGGG - Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905601726 1:39257913-39257935 CTGAAAAAGAAATAAAAGCACGG - Intronic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906524082 1:46484486-46484508 CTGTATATGTAATATGAGTATGG - Intergenic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
907875891 1:58488181-58488203 ATCTATAAACAATAAGAGGATGG - Intronic
908288067 1:62630886-62630908 TTATATAAGAAAAAAGAGGCCGG + Intronic
908950334 1:69553563-69553585 ATTTATAAAAAATAAGATGAAGG + Intergenic
909713769 1:78682269-78682291 CTGAATACGAAACCAGAGGAAGG - Intergenic
910365079 1:86456498-86456520 CTTTTAAAAAAATAAGAGGAAGG - Exonic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910619642 1:89238670-89238692 CTTTGTAAGAAATAAGAGGTAGG - Intergenic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
913564391 1:120057667-120057689 CTGAATAAGTAAGAAGTGGATGG - Intronic
913579293 1:120210194-120210216 GAGCATAATAAATAAGAGGAGGG + Intergenic
913628879 1:120688194-120688216 GAGCATAATAAATAAGAGGAGGG - Intergenic
913633737 1:120735897-120735919 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914284978 1:146217016-146217038 CTGAATAAGTAAGAAGTGGATGG - Intronic
914546009 1:148667755-148667777 CTGAATAAGTAAGAAGTGGATGG - Intronic
914561228 1:148821621-148821643 GAGCATAATAAATAAGAGGAGGG + Intronic
914611606 1:149308587-149308609 GAGCATAATAAATAAGAGGAGGG - Intergenic
914620555 1:149402911-149402933 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914944183 1:152048938-152048960 CTGTATTAGAAATAATAGGCTGG + Intergenic
915863545 1:159473545-159473567 CTGTAAAAGAAAATAGATGAAGG - Intergenic
915882163 1:159683540-159683562 CTGTGGAAGAAATAAAAGGTTGG + Intergenic
916310243 1:163390325-163390347 CTGTATAAAAAAGAGGAGAAAGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917693439 1:177492485-177492507 TTGTATAAGGTATAAAAGGAAGG + Intergenic
918375943 1:183909156-183909178 ATGTACAAGAAATAAGATGGGGG - Intronic
918697484 1:187561486-187561508 ATGTTTAAGAAATAACATGAAGG - Intergenic
919301704 1:195777489-195777511 CTCTTTCATAAATAAGAGGAAGG + Intergenic
919444441 1:197684535-197684557 GTGTATAAAAAATAAAGGGATGG + Intronic
919565869 1:199187099-199187121 CTGTCTAAGAATTCAGAGTAGGG + Intergenic
920894950 1:210038742-210038764 CTGTATAAGCAAGAAGAGAGTGG - Intronic
921421143 1:214949916-214949938 ATGTTTCATAAATAAGAGGAAGG + Intergenic
921452666 1:215327151-215327173 CTGTAAAAGAAATACTAGAAAGG + Intergenic
921546185 1:216477773-216477795 CTGATTAATAAATAAAAGGAGGG + Intergenic
921740339 1:218677456-218677478 CTGAATAAGAAATGAGAAAAGGG - Intergenic
921768133 1:218998155-218998177 CTGTATATTAAATAAGATGTTGG - Intergenic
923840219 1:237662821-237662843 CAGTTTATGAGATAAGAGGAAGG + Intronic
1065360302 10:24883382-24883404 CTTTATGAGAAATAAAGGGAGGG + Intronic
1066258189 10:33702590-33702612 CTCTATAAGGAATATGAGGAAGG - Intergenic
1067235501 10:44444423-44444445 CAGTATAAGAAATTAAAGGGAGG + Intergenic
1067734417 10:48838091-48838113 CTGTGTAAGAATTAACAGAATGG + Intronic
1072028101 10:91485202-91485224 CAGTATAAGGAATAAGGGGAGGG - Exonic
1072567128 10:96626037-96626059 GAGTATTAGAAATAGGAGGAGGG - Intronic
1072711971 10:97721754-97721776 CTGTCTCAAAAAAAAGAGGAAGG - Intergenic
1072723236 10:97793746-97793768 CTTTATATGAAATAAAAGAAAGG - Intergenic
1073533899 10:104257159-104257181 CTGTAGAGGAACTAAGAGAAAGG - Intronic
1073580357 10:104660043-104660065 CTGTGTGAGAAAAAAGAGAAAGG - Intronic
1073722269 10:106186082-106186104 CTTTATAACAAATATGTGGAGGG + Intergenic
1075906894 10:126089468-126089490 CTGTACAAAAAAGAAGAGGGAGG - Intronic
1076923576 10:133468337-133468359 GTTTTTAAGAAAAAAGAGGAAGG - Intergenic
1078279523 11:9886107-9886129 CTGTAGAATAAATTAGAGGCTGG + Intronic
1078437014 11:11333784-11333806 CTCTACAAGAAATATGAGGAAGG - Intronic
1079398469 11:20086237-20086259 GTGTATAAGGAATATGGGGAAGG + Intronic
1079814861 11:25042803-25042825 CTTTATAAGATAGAAGAAGAGGG - Intronic
1079899215 11:26160521-26160543 CTGGATGAGAAATATGATGACGG + Intergenic
1080819189 11:35788798-35788820 CTGTATCAGAAATCAGACTAAGG + Intronic
1081834363 11:46142109-46142131 CTGTATAAAAAAGAAGAAGAAGG + Intergenic
1082631085 11:55543072-55543094 TTGTGTAAGCAATAAGAGCATGG - Intergenic
1083853625 11:65381423-65381445 CTTTATAAGAAATGAGAGGCTGG - Intronic
1084170327 11:67397811-67397833 CTCAATGAGAAATAAGAGGTAGG - Exonic
1085832096 11:79912312-79912334 CTGTTTGAGAAATAATAGGGAGG - Intergenic
1086065593 11:82740387-82740409 CTGTAAAAAAAAAAAAAGGAAGG - Intergenic
1087231559 11:95671781-95671803 CTGTATCAGAAGGAAGAAGAAGG + Intergenic
1087514759 11:99143850-99143872 CTGTTTTAGAGCTAAGAGGAGGG + Intronic
1087521898 11:99248635-99248657 TTGTATAAGAAATGTAAGGAAGG + Intronic
1088900882 11:114116118-114116140 CTCTAGAAGAAATAAGAATATGG + Intronic
1089390531 11:118098784-118098806 CTGGATAAGTAAGAAGAGGCAGG + Intronic
1090046782 11:123342721-123342743 CTGTAACAGTATTAAGAGGATGG + Intergenic
1090897849 11:130994927-130994949 CTGTATTAGTAATAAGATGGAGG + Intergenic
1091245199 11:134087580-134087602 CTGTATACGTAAGAAGAGAAAGG - Intronic
1091350489 11:134890389-134890411 CTGTGGAAGCAATAACAGGAGGG + Intergenic
1091989390 12:4942584-4942606 CTGTATAAGTAACAATAGGCAGG + Intergenic
1092345058 12:7707998-7708020 CTGTAAAACACATAAGAGAAGGG - Intergenic
1092576203 12:9785417-9785439 CTGCAAAAAAAATAAGAGTAAGG + Intergenic
1092648265 12:10603475-10603497 GTTTCTCAGAAATAAGAGGAAGG - Intergenic
1093089646 12:14906721-14906743 CTGTAAAGAAAATTAGAGGAGGG - Intergenic
1093870225 12:24282207-24282229 ATATATAAGAAATAAAGGGAGGG + Intergenic
1094457214 12:30649399-30649421 CCTTATAAGAAATGAGATGATGG - Intronic
1095240234 12:39849418-39849440 CTGTCTCACAAATAAGAGGCAGG - Intronic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1095646645 12:44556069-44556091 CTGCATAATACATAAGAGAAGGG + Intronic
1095744840 12:45646392-45646414 TGGTATAAACAATAAGAGGATGG + Intergenic
1096004124 12:48155102-48155124 CTGTATAAGAGACAAGAGTTAGG + Intronic
1097699299 12:62803515-62803537 CTGTATATGATATAAGAATAGGG - Intronic
1097798873 12:63891030-63891052 CTGTACAAGGAATAAAAAGAAGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1099486738 12:83238098-83238120 TTGTATAAGGCATAAGGGGAGGG + Intergenic
1099537817 12:83866512-83866534 CAACATAAGAAATAGGAGGATGG - Intergenic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1100177645 12:92049425-92049447 CTGTGTAATGAACAAGAGGATGG + Intronic
1102726828 12:115073074-115073096 ATGAGTTAGAAATAAGAGGATGG + Intergenic
1103865109 12:124045358-124045380 CTGTAAAAGATATAAGAGAGAGG - Intronic
1104023363 12:125008612-125008634 CTGCATTAGAAAGAAGAGGAGGG - Intronic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1105555406 13:21443409-21443431 CTGTATCAGAACTAAGAGTAAGG - Intronic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1109756946 13:66773721-66773743 CTGTATTAGAAAGCAGAAGATGG + Intronic
1109996397 13:70133100-70133122 CTGTATCAGAAATAGGATGAAGG + Intergenic
1110025043 13:70526596-70526618 ATGTAAAAAAAATAAGATGAGGG - Intergenic
1110817471 13:79878043-79878065 CTGTGGATGAAATAAGGGGATGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112588069 13:100737328-100737350 CTGTAAAAGAACTAATATGAGGG - Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114043702 14:18703107-18703129 AGATAAAAGAAATAAGAGGAGGG + Intergenic
1114047989 14:18893549-18893571 AGATAAAAGAAATAAGAGGAGGG + Intergenic
1114116226 14:19625857-19625879 AGATAAAAGAAATAAGAGGAGGG - Intergenic
1114362337 14:21988517-21988539 GAGTAAAAGAAATAAGAGGTTGG + Intergenic
1116728964 14:48598034-48598056 CTGCCAAAGAAATAAAAGGATGG + Intergenic
1117813935 14:59577820-59577842 CTGTAGAGAAAAGAAGAGGAGGG - Intergenic
1118049196 14:62007944-62007966 CCCTATAAAAAGTAAGAGGAGGG + Intronic
1118204352 14:63708130-63708152 ATGTATCAGAAACAAGAGAAAGG - Intronic
1118491343 14:66263610-66263632 CTGTACAAGAAACAAGATGCTGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120152991 14:81057957-81057979 CTGTGTAAGAAACAAGATGTTGG + Intronic
1122430782 14:101640563-101640585 CTTTAAAAAAAATAAGAGCAAGG + Intergenic
1124528969 15:30486327-30486349 CTCTATTAAAAATAAGAGGCTGG - Intergenic
1124769686 15:32521364-32521386 CTCTATTAAAAATAAGAGGCTGG + Intergenic
1125141229 15:36410202-36410224 GAGTATAAGGAAGAAGAGGAAGG - Intergenic
1126899900 15:53304399-53304421 CTCCATAAGAAATCAGAGGGTGG - Intergenic
1126923167 15:53550525-53550547 ATGCATAATAAATAAAAGGATGG - Intronic
1127217529 15:56839558-56839580 CTGTATAAGAACTATGAACATGG - Intronic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129142965 15:73618577-73618599 CTTTATAAGAAATTACAGGCTGG + Intronic
1129366685 15:75060089-75060111 CCATTTAAGAAATAAGAGGCTGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130208614 15:81901933-81901955 CTTTATAAGAAAGAGGAGAAAGG + Intergenic
1132817683 16:1840848-1840870 ATGTATAAGAAATAATAAGAGGG - Intronic
1133063800 16:3192059-3192081 CTGTCTCAAAAATAAGAAGAGGG - Intergenic
1134355017 16:13474187-13474209 CTGTAGAGGAAAGAAGAAGAGGG - Intergenic
1134393909 16:13844825-13844847 TTGTACAGAAAATAAGAGGATGG - Intergenic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135129864 16:19844441-19844463 CTTTATAGGAAAGAAGAGTATGG + Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1137499699 16:49000948-49000970 CTGTACAGGAAATAAATGGATGG + Intergenic
1137756678 16:50907858-50907880 CTGTATAAGAAACTAGACCAAGG + Intergenic
1138821521 16:60265907-60265929 TTGTGTGAGAAATAATAGGAGGG - Intergenic
1138994728 16:62435812-62435834 CAGCTTAAGAAATAAGAGGTAGG + Intergenic
1139810055 16:69607264-69607286 GTTTATAATAAATAAGAGGTAGG - Intronic
1140334680 16:74094122-74094144 CTGTGTATGAAATAAGAATAGGG - Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1144018135 17:11216412-11216434 CTGTCTGAGAAATGGGAGGATGG - Intergenic
1145281897 17:21474152-21474174 CTGTATAAGGAAGAAGAGGGTGG - Intergenic
1145395552 17:22491468-22491490 CTGTATAAGGAAGAAGAGGGTGG + Intergenic
1147029852 17:37623971-37623993 TTCTATAAGAAACCAGAGGAGGG + Intronic
1149276884 17:55051048-55051070 TTGTAAAAGAAATCAAAGGAGGG + Intronic
1149507822 17:57210677-57210699 GTGTAAAAGAAAAAAGAGGTGGG + Intergenic
1150379148 17:64707167-64707189 AGGTACTAGAAATAAGAGGAAGG + Intergenic
1150563831 17:66320038-66320060 ATGTATATGAATTAAGAGGCAGG - Intronic
1151515344 17:74590780-74590802 ATTTATAAGAAATAAGAGCTGGG + Intronic
1152940375 17:83169087-83169109 CTGTATAAGCAAGAAGAGAGTGG - Intergenic
1154062481 18:11075370-11075392 CTGTCAAAGAAATGAGAGAAAGG + Intronic
1156138924 18:34081016-34081038 CTTTTTAAGAAATTAGAAGATGG + Intronic
1156568253 18:38220981-38221003 CTGTGAAAGACACAAGAGGAGGG - Intergenic
1156643689 18:39133469-39133491 CCATATAAGAAAAAAGACGATGG - Intergenic
1157386898 18:47264944-47264966 TTGAAAAAGAAATAAAAGGAAGG - Intergenic
1158510110 18:58082909-58082931 CTGTATTACAAATAAGGTGATGG + Intronic
1159749846 18:72286677-72286699 CTGAATAAGAAATAAGAAAGAGG + Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1162424081 19:10583601-10583623 CTGTATAAGACAATAGAGGTAGG - Exonic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163388370 19:17014357-17014379 CTTAAAAAAAAATAAGAGGACGG - Intronic
1166403270 19:42500160-42500182 CTATTTAAAAAAGAAGAGGAGGG - Intergenic
1166549511 19:43655952-43655974 ATGTGTAAGAAACAAGAGGGTGG + Intronic
1167151475 19:47712838-47712860 CTCTAAAAAAAATAATAGGACGG - Intergenic
925629294 2:5872821-5872843 CAGTTTCAGAAATAAGAAGATGG - Intergenic
928163648 2:28952760-28952782 AGGTACAAGAAATAAAAGGAGGG + Intergenic
929024759 2:37589229-37589251 CTGTATAAGATAGGAGGGGAGGG + Intergenic
929219719 2:39450499-39450521 TTGTAAAAGAAACAAAAGGAAGG + Intergenic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929960506 2:46492680-46492702 AGGTATAAGAAAGAAGAGGGAGG + Intronic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
930530176 2:52580013-52580035 CTGCATGAGAAATAAGGGGTGGG + Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932846992 2:75146067-75146089 TGGTATAAGACATAGGAGGAAGG + Intronic
933624014 2:84577966-84577988 CTGTATACAAAACAAGAGGCAGG - Intronic
934739527 2:96709741-96709763 CTATACAACAAGTAAGAGGATGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935452281 2:103223715-103223737 CTTAATAAGAAATATGAGGCCGG + Intergenic
935582597 2:104770802-104770824 TTGTATAAGATATAAGATAAGGG - Intergenic
937310613 2:120900600-120900622 CTGTGGAAGAAACAAGATGAGGG + Intronic
938425365 2:131182062-131182084 AGATAAAAGAAATAAGAGGAGGG + Intronic
938450796 2:131417869-131417891 ATGTATAACAAATATGGGGAGGG + Intergenic
939137269 2:138312397-138312419 CTGTGTTAGAAATGAGAGAATGG - Intergenic
939225824 2:139362948-139362970 TTATTTTAGAAATAAGAGGAAGG - Intergenic
940082028 2:149813754-149813776 CTGTATAAGGAATAGGTGAAAGG + Intergenic
941733991 2:168952262-168952284 CTATTTTAGAAATCAGAGGAGGG - Intronic
941803838 2:169690301-169690323 CTTTTTAAAAAATAAGAGGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942663415 2:178290141-178290163 ATGTAGAAGGAATAATAGGATGG - Intronic
943857545 2:192816880-192816902 TTGTATAAATGATAAGAGGAAGG + Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945390588 2:209260926-209260948 CTTTATAAAAAATAAGATGGGGG - Intergenic
946774341 2:223122139-223122161 CTCTAAAAAAAAGAAGAGGAAGG - Intronic
946873141 2:224102802-224102824 ATGGAAAGGAAATAAGAGGAAGG - Intergenic
947699380 2:232219681-232219703 CTGGCAAGGAAATAAGAGGAAGG - Intronic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
1169095709 20:2896812-2896834 CTGAATCAGAAATAAGTGAAGGG - Intronic
1169197437 20:3691124-3691146 TTGTATAAGAAATAAATGGCTGG - Intronic
1169480907 20:5979767-5979789 CTGTATTAAAAACAACAGGAAGG - Intronic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1169958019 20:11127372-11127394 GTGGATAAGAAGTAAGAGAAGGG - Intergenic
1170394227 20:15908655-15908677 CTGAGTAAGAAATAAAAGAAAGG - Intronic
1171009387 20:21500106-21500128 CTGTACCAGAAATCAGAAGATGG - Intergenic
1172829933 20:37825049-37825071 ATGACTAAGAAATAAGAGAATGG + Intronic
1173603663 20:44313814-44313836 CAGCATAAGAATTAAGAGCAGGG + Intergenic
1174559418 20:51419425-51419447 CTGGATGGGAAAAAAGAGGAAGG - Intronic
1174701298 20:52611646-52611668 CTGTATAAGAAAGAAGGAGATGG - Intergenic
1175579663 20:60088574-60088596 CTAAAGAAGAAATGAGAGGAGGG - Intergenic
1177089410 21:16748245-16748267 CTGTATAAGAAGTATGATGCTGG - Intergenic
1177298850 21:19214004-19214026 CTTTTTAAGAAACAAAAGGACGG + Intergenic
1177590646 21:23161569-23161591 TGGTATAATAAATAAGAGCAGGG - Intergenic
1179042795 21:37818880-37818902 CTGTAAGAGAAATAAGTGGTTGG + Intronic
1179281281 21:39936497-39936519 CTGTAAAAGAAAGAATAGCATGG - Intergenic
1179561384 21:42218400-42218422 CTGTATAAGGAATAACACCAGGG - Intronic
1180466524 22:15616225-15616247 AGATAAAAGAAATAAGAGGAGGG + Intergenic
1181444866 22:22961628-22961650 ATGTATAAGGAACTAGAGGAAGG + Intergenic
1182129656 22:27841673-27841695 CTGTATTAGAAATTAGATCACGG - Intergenic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
949226715 3:1703970-1703992 CTGAATAAAAAATAAGAAAAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950051207 3:9991126-9991148 CTCTATAAAAAATAAAAGAATGG - Intronic
951200447 3:19870907-19870929 CTTTATAAGAAATCAAAAGATGG - Intergenic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
951222838 3:20086695-20086717 CTGTATTAGAAATGAAAGGTGGG + Intronic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952689831 3:36192211-36192233 CTGAATCAGAAATAAGAAAATGG - Intergenic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
957631779 3:82725167-82725189 CTGCAGCAGAAATAAGAGGGAGG + Intergenic
957660086 3:83138795-83138817 CTTAAAAAGAAATAAGAGAATGG + Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957926547 3:86821714-86821736 CGGTATGAGAAATAAAGGGACGG + Intergenic
957985268 3:87566631-87566653 CTGTAATAGAAAGAAGAGGGAGG + Intergenic
958540045 3:95459192-95459214 GTTTATAAGAAATAAGAACATGG - Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
961235186 3:125360257-125360279 CTGTCTAAAAAAAAAGATGAAGG - Intronic
961560845 3:127728647-127728669 CTGTTTAATAAATAAGAGCTTGG - Intronic
962729781 3:138270331-138270353 CTTAATAATAAATAAGAGAACGG - Intronic
963386484 3:144601179-144601201 ATGTATAAGACAAAAGAGAATGG - Intergenic
964260996 3:154836566-154836588 CCGTAAAACAAATTAGAGGATGG + Intergenic
964403036 3:156319161-156319183 CTGTATGAAAAATCACAGGAGGG - Intronic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966632215 3:182089754-182089776 TTTTATCAGAAATAAGAGAAAGG + Intergenic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967270713 3:187729809-187729831 CTGTACATGGAATAAGAGGCTGG + Exonic
967678214 3:192326342-192326364 AAGTAAAAGAAATTAGAGGAGGG + Intronic
968081841 3:195851926-195851948 TTGTACAAGAGATAAGAGGCTGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969600840 4:8175398-8175420 CTGGATAAGAAAACACAGGAAGG - Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
974062648 4:57049526-57049548 TGTGATAAGAAATAAGAGGAGGG - Intronic
974144640 4:57931987-57932009 CAGAATAGGAAATAAGAGTATGG + Intergenic
974884342 4:67798888-67798910 CTATGTAAGAACTTAGAGGAAGG + Intergenic
975969479 4:80016272-80016294 CTGGAGTAGAAATAAGTGGAAGG - Intronic
975983265 4:80182885-80182907 CTGAGTAAGAAATAAAATGAGGG - Intergenic
976553859 4:86427835-86427857 CTTTATAATAATTGAGAGGAGGG - Intronic
976767729 4:88615574-88615596 CAGTATAATGAATAAGAGCATGG + Intronic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
978033671 4:103969236-103969258 CTGTCTCAAAAATAAAAGGAAGG - Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978499716 4:109396189-109396211 CTGTCTATAAAATAAGAGGTAGG - Intergenic
978661733 4:111135676-111135698 CTGGATTAAAAATAAAAGGATGG - Intergenic
978764783 4:112392881-112392903 CTGTATCTGAAAGAACAGGAAGG + Intronic
979686613 4:123517396-123517418 CTGTAGAAGACATAAGGGAATGG + Intergenic
981082860 4:140652368-140652390 CTGTGCAACAAATTAGAGGAGGG - Intronic
981872431 4:149502825-149502847 ATGTACAAGCAATCAGAGGAAGG + Intergenic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
983495778 4:168441010-168441032 CTGTTAAAGAGATGAGAGGAGGG + Intronic
984622801 4:181973165-181973187 CTGCATATGTTATAAGAGGAAGG - Intergenic
984798843 4:183693500-183693522 ATTTAAAAGAAATAAGAGGCTGG - Intronic
985295671 4:188434966-188434988 CTGTAGAAGAGACAAGAGAAAGG + Intergenic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
985497452 5:217902-217924 ATGTATAATAAACAAGAGGTCGG + Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
989224174 5:39006665-39006687 CTTTAGAGGAAATAAGGGGAGGG + Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
991073290 5:62510697-62510719 CTGTGAAAGATATAAAAGGAAGG - Intronic
991211489 5:64110047-64110069 CTCAAGAAGACATAAGAGGAAGG + Intergenic
991249284 5:64542102-64542124 ATATATAAGGAATAAGAAGATGG - Intronic
992963645 5:81980124-81980146 CTGGATAAGAAAAAACTGGAAGG - Intronic
993303747 5:86249115-86249137 TTGTAACAGAACTAAGAGGATGG + Intergenic
994303029 5:98169591-98169613 CTGTTTGAGAAATAAGATGCAGG + Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
996664833 5:126047071-126047093 GTCTATAAGGAATAAGTGGAAGG - Intergenic
997649977 5:135509714-135509736 CTGTTTCAGACATCAGAGGAGGG - Intergenic
998682562 5:144486597-144486619 CTGTACAAGAAATACAAGGAAGG - Intergenic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1002445854 5:179289344-179289366 CTGAATAATAAATAAGTGGGAGG + Intronic
1004126073 6:12874898-12874920 CTAAATAACAAATAAAAGGAGGG - Intronic
1004470401 6:15923804-15923826 CTGTATAAAACACAAAAGGATGG - Intergenic
1004959527 6:20771004-20771026 CTGTTGAACAAATAAGTGGAAGG - Intronic
1004987107 6:21095048-21095070 CAGTATACGCAATAAGTGGATGG + Intronic
1005952779 6:30643687-30643709 CTGTCTAAGAAAGTAGAAGAGGG - Intronic
1006237841 6:32651204-32651226 CTGTAAAAGTAATAATAGAATGG + Intergenic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1007956592 6:45923553-45923575 CTGTTTAACAAATAAAAGAATGG - Intronic
1009050411 6:58268353-58268375 CTGTAGAAGAAATAAAGTGAAGG - Intergenic
1009469775 6:64017963-64017985 TTGTATAAGAAATAATATGTTGG + Intronic
1009629843 6:66181855-66181877 CTATCTAACAAAAAAGAGGAAGG - Intergenic
1010097045 6:72058712-72058734 CTCGGCAAGAAATAAGAGGAAGG - Intronic
1010568240 6:77444526-77444548 CTGTATAAGAAATCAGTTGGTGG - Intergenic
1010877250 6:81122612-81122634 TTGTAATAGAAATAAGAGAAGGG - Intergenic
1011012885 6:82721874-82721896 GTTAAGAAGAAATAAGAGGAAGG - Intergenic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1012189940 6:96266518-96266540 CTGAAAAAAAAATAAAAGGATGG - Intergenic
1012501360 6:99891335-99891357 TACTATAAGGAATAAGAGGAAGG - Intergenic
1012578588 6:100834133-100834155 ATGAATAAGTAATAAAAGGAGGG + Intronic
1012716649 6:102681810-102681832 CTGAATCAGAATTTAGAGGAGGG + Intergenic
1012839640 6:104313526-104313548 CTTTTTAAGAAATAAGTAGAGGG + Intergenic
1012979620 6:105815896-105815918 CTCTATAAGAAGTAACAGAAAGG + Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015222814 6:130824409-130824431 TTGTTTAAGACATAGGAGGAAGG - Intergenic
1015621087 6:135132431-135132453 CTGTAAAGGAAAGAAGAGAAGGG - Intergenic
1016080959 6:139855425-139855447 CTGTTTAAGCAATGAGAAGATGG - Intergenic
1016640262 6:146340404-146340426 CTGTGTAAGAAATTAGTGCAAGG + Intronic
1017150300 6:151273317-151273339 CAGTATCAGCAATAACAGGAGGG - Intronic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021462434 7:20903529-20903551 TTCTATAAGATATAAGAGAATGG + Intergenic
1022282304 7:28923624-28923646 ATGAATAAGAAATGAGTGGAGGG - Intergenic
1022544037 7:31168800-31168822 CTGTGGAAGAAAGAAGAGGTTGG - Intergenic
1022971164 7:35518608-35518630 CTCTTGAAGAAATAGGAGGATGG - Intergenic
1025251902 7:57357070-57357092 ATTTTTAAGAAATAAGAGGCCGG + Intergenic
1026659257 7:72284928-72284950 CTGTAGAGGAAAAAAAAGGAAGG - Intronic
1026794376 7:73357080-73357102 CTGAATAAGACATGAGAGGAGGG - Intronic
1028678719 7:93499746-93499768 CTGTGTAAGATATAATAGAAGGG - Intronic
1028829361 7:95310607-95310629 CCAGATAAGAAAGAAGAGGAAGG + Intronic
1031713774 7:125081434-125081456 CTGTCTAAGAACGCAGAGGAAGG - Intergenic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1033249146 7:139743738-139743760 CTGAACAAGACATAAGGGGATGG + Intronic
1033638905 7:143241606-143241628 CTGTGTAGGAAGTAAAAGGAAGG - Intergenic
1033681772 7:143602325-143602347 CCGTATAAGAAAGAAAATGAGGG - Intergenic
1033703117 7:143859588-143859610 CCGTATAAGAAAGAAAATGAGGG + Intronic
1033933489 7:146553296-146553318 TTATATAAGAAATAAAAGAATGG - Intronic
1034140112 7:148807701-148807723 CTGTATCTGAAACAACAGGAAGG + Exonic
1034444059 7:151103080-151103102 CAGTATGAGAACTAAGAGAAAGG - Intronic
1035970609 8:4243828-4243850 ATGTATAAGAAAACAGAGTAGGG + Intronic
1037081031 8:14786908-14786930 CTGTATGATAAATTAGAGGAGGG + Intronic
1037939267 8:22939553-22939575 ATGTCTAAGAAATGGGAGGAAGG + Intronic
1038146920 8:24905664-24905686 TTGTATAGGGAAGAAGAGGAGGG - Intergenic
1038911169 8:31966347-31966369 CTGGAAAAGCAATAAGAGTAGGG + Intronic
1039507938 8:38065625-38065647 CTGTTTAAGAAAAAAGAAAAAGG + Intergenic
1039773832 8:40716278-40716300 CTGCATCAGAAATATGGGGAGGG + Intronic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041967007 8:63689769-63689791 CTATATAAAAAACAAGAGGAAGG - Intergenic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1042390652 8:68229809-68229831 CTGTCAGGGAAATAAGAGGAAGG + Intronic
1043040558 8:75257367-75257389 CAGTCTAAGAAATAAGAAAATGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044252895 8:90024892-90024914 TTGTATAAGGAGTAAAAGGAAGG + Intronic
1044257348 8:90081548-90081570 CTGTGTGAGAAATAAGGGGGTGG - Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044437916 8:92187846-92187868 GTGTATGAAAAAAAAGAGGAGGG - Intergenic
1044689996 8:94867946-94867968 TTGTAAAAGAAATAAGATGCTGG - Intronic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1045760575 8:105601645-105601667 CTATATAGGAAATAAGATGTTGG + Intronic
1046629058 8:116605269-116605291 CTGGAGAGGAAATAAGAGAAGGG - Intergenic
1047064941 8:121271331-121271353 CTTTTAAAGAAATAGGAGGATGG + Intergenic
1048652345 8:136492089-136492111 CCGTAGAAGAAACAAGAGAAAGG + Intergenic
1048802779 8:138209397-138209419 ATACATAAGGAATAAGAGGAGGG + Intronic
1050210915 9:3255151-3255173 CAGTTTAAGAAATAAGAATATGG + Intronic
1050278793 9:4028892-4028914 TTGCATAAGGAATAAGAGAAGGG - Intronic
1050386450 9:5096201-5096223 AGGTAGAAGAAATAAGTGGAGGG - Intronic
1050833509 9:10046061-10046083 CTGTATATCAAATTAAAGGAAGG - Intronic
1051595877 9:18823987-18824009 CTCAATAAGAAAGAAAAGGAAGG + Intronic
1051999092 9:23254559-23254581 ATTTATAAGAAACAATAGGAAGG + Intergenic
1052018855 9:23501694-23501716 CTTCATAAGAAAGAAGAGCAAGG + Intergenic
1052257106 9:26470463-26470485 CTGAATAAGCAATAATAGAATGG - Intergenic
1052331570 9:27275202-27275224 CTTTGTAAGAAATAAGAGGAAGG + Intergenic
1052496984 9:29239666-29239688 CTGAATCAGAAATTTGAGGATGG + Intergenic
1052659309 9:31407707-31407729 CTGCATAAGACAGAAAAGGATGG + Intergenic
1053277204 9:36792192-36792214 CTGTATAAGAAATAGGCTGTTGG + Intergenic
1054779998 9:69157283-69157305 GGGTATGAGAAATAAGACGATGG - Intronic
1055069356 9:72150101-72150123 TTGTGAAAGAAATAAGAGGAGGG + Intronic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1057932099 9:99202959-99202981 CTTTTTAAGAAAAAAAAGGATGG + Intergenic
1058296919 9:103320226-103320248 ATGTAGAAGAAATAAGATGTTGG + Intergenic
1059243182 9:112826117-112826139 CTGAATAAGACTTGAGAGGATGG - Intronic
1187558888 X:20380475-20380497 CTATATCAGAAATATGAAGATGG + Intergenic
1187704510 X:21996168-21996190 CTGTGTAAGATATAAAATGATGG + Intergenic
1187919557 X:24187869-24187891 CTTTAGAAGCACTAAGAGGATGG + Intronic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1189101818 X:38198318-38198340 CTGTAAAAGAAATGTGGGGAGGG + Intronic
1189711434 X:43816741-43816763 CTGAGAGAGAAATAAGAGGAAGG + Intronic
1190000135 X:46678101-46678123 CTGTATTAGGAATAAAAGAAGGG - Intronic
1192028794 X:67486759-67486781 GAGGGTAAGAAATAAGAGGAGGG + Intergenic
1192689066 X:73341578-73341600 CTGTACAAGACATAAAAGGCTGG - Intergenic
1194150053 X:90313094-90313116 GTGAATAACAAATAACAGGAAGG - Intergenic
1196911595 X:120489390-120489412 CAGTTTAAGAAATAATAGGCTGG + Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197340292 X:125257733-125257755 CTTTAGGAGAAATAAAAGGAAGG - Intergenic
1197959323 X:131986758-131986780 CTTTATTAGAAATACCAGGAGGG + Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1199329781 X:146545334-146545356 CTGTAAAAAAAAAAAGAGGTTGG + Intergenic
1199446128 X:147924183-147924205 GTGTATAATAACTCAGAGGAGGG + Intronic
1199609842 X:149603634-149603656 ATATTTTAGAAATAAGAGGATGG + Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic