ID: 1014730111

View in Genome Browser
Species Human (GRCh38)
Location 6:125022552-125022574
Sequence GGGTGTGGTTGTTCCTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014730111 Original CRISPR GGGTGTGGTTGTTCCTTTAA GGG Intronic
903116707 1:21184207-21184229 GAGGGTGGTGGTTCCTTTTATGG + Intergenic
903439676 1:23378220-23378242 GGGTGTGGTGGTTCCAGTACTGG + Intergenic
909198750 1:72661380-72661402 AGTTGTGGTTCTTCCTCTAAGGG + Intergenic
910357919 1:86381423-86381445 GTGTGTGTGTGTTCCTTTAAAGG - Intronic
917254212 1:173097247-173097269 TGCTGTGGGTGTTCCTTTATGGG + Intergenic
919881078 1:201901005-201901027 GGTTGTGGCAGTTCCTTTTATGG + Intronic
1063900044 10:10723206-10723228 TGGTGTCGTTGTTGTTTTAATGG + Intergenic
1065311890 10:24424262-24424284 GGGTGTGTGTGTTCCTCAAATGG - Intronic
1066200917 10:33142096-33142118 GAGAGTGGCTGTCCCTTTAATGG + Intergenic
1070887826 10:79920738-79920760 GTGTGTGGTTGTCCCTTCAGAGG + Intergenic
1071271574 10:84012247-84012269 GAGTTTGGTTCTTCTTTTAAGGG + Intergenic
1072085170 10:92072162-92072184 GGGTATGTTTTTTCATTTAAAGG - Intronic
1076296917 10:129392619-129392641 GGATGTGATTGTTCTTGTAAAGG + Intergenic
1077944586 11:6881545-6881567 GGGTGTGGGTTTTCTTTTAGGGG - Intergenic
1086894363 11:92294984-92295006 TGGAATGGTTTTTCCTTTAAAGG + Intergenic
1089336849 11:117731020-117731042 GGTTGTGGGGTTTCCTTTAAGGG + Intronic
1092232307 12:6782972-6782994 GGGTGGGGTTCTTCCTTTGAAGG + Intergenic
1094263067 12:28523708-28523730 GGTAGTGGTTGTTCCTTTCCAGG + Intronic
1097708500 12:62893647-62893669 GGGTGTGGTTTTTCTTTTTCAGG + Intronic
1102543823 12:113640683-113640705 GGGTTTGATTTTTCCTTCAAGGG - Intergenic
1103793873 12:123490241-123490263 GGGTTTGGGAGTTCCTTTGAAGG - Intronic
1105252238 13:18709713-18709735 GGGGGGAGTTGTTGCTTTAAGGG + Intergenic
1107741624 13:43456436-43456458 GGGTGTGCTTTTTCCTTGACTGG + Intronic
1107919046 13:45184265-45184287 GGGTGTGGCTGTTCCCTTGTTGG + Intronic
1110960351 13:81614585-81614607 GGATTTGGTTTTTCTTTTAAGGG - Intergenic
1111197327 13:84892315-84892337 GTGTCTGGATCTTCCTTTAAAGG + Intergenic
1111332588 13:86779657-86779679 GAGTCTGGGTGTTCCTTTATTGG - Intergenic
1112010023 13:95286019-95286041 GGGTGTGGTGGTGCTATTAACGG + Intronic
1115324367 14:32122087-32122109 GAGTCTGGTAGTTCCTTAAAAGG - Intronic
1116756058 14:48949638-48949660 GGCTGTGGGTGTTCCTTTGAGGG - Intergenic
1120465528 14:84852397-84852419 AGGTGTGGTTTTTACATTAACGG + Intergenic
1121024811 14:90607830-90607852 GTGTGTGGTTGTTTATGTAAAGG + Intronic
1122106177 14:99457476-99457498 TGATTTGGTTGTTCCTTAAATGG - Intronic
1130807521 15:87341437-87341459 GGCTGCAGTTGTTCTTTTAAAGG + Intergenic
1130994350 15:88895602-88895624 AGGTGCGCGTGTTCCTTTAAGGG - Exonic
1135175141 16:20221328-20221350 GGGGGAGGTTGTTCCTTTCTGGG - Intergenic
1135841088 16:25876898-25876920 TGTTTTGGTTGTTCCTTTACAGG + Intronic
1139035397 16:62940072-62940094 GAGGGTGGGTGTACCTTTAAAGG - Intergenic
1140524129 16:75608121-75608143 GGGTATGGTTGTTCTTTTTGGGG + Intronic
1140780141 16:78288447-78288469 GGCTGTGGTTGTCAATTTAATGG + Intronic
1141415329 16:83867387-83867409 GGATATGGTTGTTCCTATATTGG + Intergenic
1142319020 16:89369123-89369145 TGGTGTGGTTGGTCCTTTCTAGG - Intronic
1144345575 17:14346215-14346237 GGATGTGGATGTCCCTGTAAAGG - Exonic
1148484322 17:47981007-47981029 GGGAGTGGGTTTTCCTTAAAAGG + Intronic
1152399185 17:80054407-80054429 GGAAGTGTTTGTTCCTTGAAAGG - Intronic
1158542277 18:58367737-58367759 GGGTGTAGTTGTCCCTTTTGAGG - Exonic
1159156673 18:64592250-64592272 GGGTGTGGTTGATATTTTCATGG - Intergenic
1160035045 18:75292433-75292455 GGGTGAGGATGTTGCTTTATAGG + Intergenic
1160135355 18:76266630-76266652 GGTTTTGTTTGTTCCTTTACAGG - Intergenic
1161452501 19:4354315-4354337 GGGTGTGGGGGTTCCTGTAGGGG - Exonic
1163007522 19:14406089-14406111 GGGTCGGGTTGTCTCTTTAAAGG + Intronic
1163666169 19:18605114-18605136 AAGTGTGTTTTTTCCTTTAAGGG - Intronic
1165174142 19:33914740-33914762 GAGTGTGGTTTTTCTTGTAATGG - Intergenic
1165964923 19:39568883-39568905 GGATCTGGTTCTTACTTTAATGG - Intergenic
1165966721 19:39587458-39587480 GGATTTGGTTCTTGCTTTAATGG + Intergenic
928134764 2:28679928-28679950 GGCTGTGGCTGCTCCTTTAGAGG - Intergenic
930067027 2:47335485-47335507 GGGGGGGGTTGTTGCTTTGAGGG - Intergenic
935223238 2:101032818-101032840 GGGTTTGGCTGCTGCTTTAATGG + Intronic
940102190 2:150054160-150054182 TGATGAGGTTGTTCCTTTGATGG + Intergenic
944330601 2:198461921-198461943 GGGTCTGGTTCTTGCTTTTAAGG + Intronic
947133415 2:226953295-226953317 CGGTGTGGTTGTGCCATTTAAGG + Intronic
947871721 2:233442281-233442303 GGGTGGGGCTGTTGCTTTACTGG + Intronic
1174350915 20:49967214-49967236 GGGTGTGGGGGTTGCTATAAAGG + Intergenic
1175947723 20:62566493-62566515 GGGTGTGGCCGTGCCTTTCAGGG + Intronic
1179561945 21:42220918-42220940 TGGTGTGGGTTTTCCTATAATGG + Intronic
1179562156 21:42222436-42222458 TGGTGTGGATTTTCCTATAATGG + Intronic
1181973284 22:26709963-26709985 GTCTGTGGTTGTCCCTTAAATGG - Intergenic
1181984354 22:26789312-26789334 GAGTGTGTTTGCTCCTTTCAGGG - Intergenic
1182106495 22:27693594-27693616 GGGAGTGGGTGCTGCTTTAATGG + Intergenic
953669797 3:44952693-44952715 GGGTTTGGTTGGTGCTTAAATGG - Intronic
953846937 3:46435055-46435077 GGGTGAGACTGTTCCTTCAAGGG - Intergenic
957348333 3:78990968-78990990 GTCTGTGGTTGTTCCATTTAAGG + Intronic
960765801 3:121128508-121128530 GGTAGTGGTTGTCCCTTTTAAGG + Intronic
962324113 3:134418978-134419000 GGGTGTGGTTCTTCCTGCAAAGG + Intergenic
970430167 4:15981933-15981955 GGAAGTGGTTCTTCCTTCAAGGG + Intronic
970599047 4:17626528-17626550 GGGTGTGGTAGCTCTTTGAAAGG + Exonic
972267685 4:37478495-37478517 GGAAGTATTTGTTCCTTTAAGGG - Intronic
972965706 4:44507005-44507027 AGGTATTGTTGTTCCTTAAAAGG + Intergenic
980192462 4:129542454-129542476 GGGTGTGCTTGGTCTTTTGATGG + Intergenic
983445884 4:167851445-167851467 TGCTGTTGTTGTTCCTTAAATGG + Intergenic
983853791 4:172616858-172616880 GGGTGTGTGGGTTCCTTGAAAGG - Intronic
983963107 4:173778223-173778245 GGGTGTGGTTGTCTGGTTAATGG + Intergenic
985992516 5:3575121-3575143 GGCTGTGGATGTACCTTTAGGGG - Intergenic
989773130 5:45168605-45168627 GGGTGTCTATGTTCCTTTAGGGG + Intergenic
998517037 5:142765816-142765838 GGGTGAAGTTGTTCCACTAAAGG - Intergenic
1002444955 5:179284783-179284805 GGGTGTGTCTGTTCCTTAAGTGG - Intronic
1002602653 5:180362835-180362857 GAGTGTGGCTGTTTCTTCAAGGG + Intergenic
1002664664 5:180814288-180814310 GAGTGTGGTTGTTTCTTTATGGG - Intronic
1003059868 6:2854438-2854460 GGGGGTGTTTGTGCCTTAAAGGG + Intergenic
1003472191 6:6447416-6447438 GGGTATGTTTGTTCATTTCAGGG + Intergenic
1005567031 6:27106541-27106563 GGGTGTGATTGTGTCTTTTATGG - Intergenic
1007787789 6:44291154-44291176 TGGTATGGATGTTCCTATAAAGG - Intronic
1009027514 6:58017450-58017472 GGGTGGGGTAGGTCCTCTAAAGG + Intergenic
1010209091 6:73348821-73348843 GGGTGTGGGTGTTCCTCGCAGGG - Intergenic
1011485980 6:87841959-87841981 TGTTGTTGTTGTTGCTTTAATGG + Intergenic
1012112461 6:95254361-95254383 TGGTGTGTTTATTCCTATAATGG - Intergenic
1013801715 6:113953436-113953458 AGTTTTGGTTTTTCCTTTAAAGG + Intronic
1014244665 6:119055009-119055031 GGCTGTGGTGTTTCCTTTTAGGG - Intronic
1014730111 6:125022552-125022574 GGGTGTGGTTGTTCCTTTAAGGG + Intronic
1017046698 6:150353099-150353121 AGGTGTTGTTGTTGCTCTAAGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1022181517 7:27925216-27925238 CTGTGTGGTTTTTACTTTAAGGG - Intronic
1023032401 7:36101940-36101962 GGATGTGTTTCTTGCTTTAACGG - Intergenic
1024288547 7:47782233-47782255 GGGTGTTGTAGGTCCTTCAAAGG + Intronic
1026586850 7:71662506-71662528 GGGTTTGGTGGTTCTTTTTAGGG - Intronic
1032627802 7:133611518-133611540 GGGTGTGGTAGGTCCTATGAAGG - Intronic
1038295700 8:26289689-26289711 TGGTGCAGTTGTTCCTTTGAAGG + Intergenic
1041246541 8:55894106-55894128 GGGTATGGTTATTCCTTGCATGG - Intronic
1042521444 8:69715937-69715959 GGGTGTGGTGTTTCTTTTTAGGG - Intronic
1042946795 8:74163291-74163313 TGGTGTTGTTTTTCCATTAATGG - Intergenic
1044087957 8:87964779-87964801 GTGTGTGGTTGTGTTTTTAATGG - Intergenic
1049119607 8:140722725-140722747 GGGTGTGGTGTTTATTTTAAGGG - Intronic
1049816235 8:144603789-144603811 GGGAGTGCTGGTTCCTTTTAGGG - Intronic
1052840000 9:33284785-33284807 GGGTTTGGGTGTTTCTTTATGGG + Intergenic
1054933703 9:70664605-70664627 GGGTGTGGTTGTGGCTCTCATGG - Intronic
1055214752 9:73845638-73845660 GGGTGAGGTTTTTTCTTTTATGG - Intergenic
1055721863 9:79183558-79183580 GGGTTTGGTTTTTCATTTAAAGG - Intergenic
1058066769 9:100557249-100557271 GGGTGTGGAGGTTCTTTTAGGGG - Intronic
1060422941 9:123482655-123482677 GGGGGTAATTGTTCCTTTATGGG - Intronic
1061107860 9:128545932-128545954 GGGTGTGTTTTTTGCTATAAAGG + Intergenic
1187136514 X:16552514-16552536 TGGTTTGGTTCTTCCTTTTATGG + Intergenic
1187474841 X:19601747-19601769 AGGTGTGGCTGTTCCTCTAGGGG - Intronic
1187702300 X:21974422-21974444 GGGTGTGGATGTGTTTTTAAAGG - Intronic
1188170190 X:26914974-26914996 GGATGTAATTGTTACTTTAATGG + Intergenic
1189185439 X:39050931-39050953 GGATGTGCATGTTGCTTTAAGGG + Intergenic
1189836243 X:45026021-45026043 GGGTGTTGGTGTTTCTTGAATGG + Intronic
1190117835 X:47637639-47637661 GAGTGTGGTTGTTCCTGAAGAGG - Intronic
1192622215 X:72689773-72689795 GAGTCTGGTAGTTCCTTAAAAGG - Intronic
1193024313 X:76828559-76828581 GGCTGTGGTTGTTTGTTTAGTGG + Intergenic
1198730261 X:139720749-139720771 GGGGGGGGTTGTTGCTTTGAGGG - Intergenic
1200927733 Y:8669615-8669637 CTGTGTGTTTGTTCCTGTAAAGG + Intergenic