ID: 1014732068

View in Genome Browser
Species Human (GRCh38)
Location 6:125043984-125044006
Sequence TAAGGTAGTTAAGAAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014732068 Original CRISPR TAAGGTAGTTAAGAAGTTGC AGG (reversed) Intronic
900283669 1:1889273-1889295 TTAGGTGATTAAGCAGTTGCTGG - Intronic
901500215 1:9648158-9648180 TAAGGCAATTAAGAAGCAGCAGG - Intergenic
901607011 1:10467113-10467135 TATGGAAGCTAAGAAGGTGCTGG + Intronic
904019452 1:27451342-27451364 AAAGCTAGTTAAGAACTTCCAGG + Intronic
904041682 1:27589028-27589050 GAAGGTAGGTAAGAGGTTTCAGG + Intronic
905153877 1:35957042-35957064 CATGGTTGTTAAGAAGTTGGTGG + Intronic
905669123 1:39779437-39779459 TCAGGTTGTTCAGAGGTTGCTGG + Intronic
906289699 1:44611562-44611584 TAAGGGAGTTGACAGGTTGCTGG - Intronic
909138731 1:71835468-71835490 TAAGGAAGTAGAGAGGTTGCAGG - Intronic
910125334 1:83835220-83835242 TAAGGTTTTTAAAATGTTGCAGG - Intergenic
910489511 1:87753269-87753291 TAAGGCAGTAAAGAAGTCACTGG - Intergenic
912401032 1:109392988-109393010 TGAGGCAGTTAGGAAGTTCCGGG + Intronic
914333148 1:146691088-146691110 TAAGGTACCTCAGGAGTTGCCGG - Intergenic
922479164 1:225926948-225926970 TCAGGTAGTGAGGAAGTTGGGGG + Intergenic
923387627 1:233480910-233480932 TTAGGGAGTTCAGAAATTGCAGG + Intergenic
923619300 1:235565021-235565043 CATGGTAGGAAAGAAGTTGCAGG - Intronic
1067002721 10:42632421-42632443 TCAGGTAGATCAGAAGTTCCAGG - Exonic
1067498530 10:46780957-46780979 GAATGTAGTTAAGAATTTTCAGG - Intergenic
1067596116 10:47559457-47559479 GAATGTAGTTAAGAATTTTCAGG + Intergenic
1068411437 10:56660712-56660734 TAGGGTAGCTAAGAGGGTGCTGG - Intergenic
1069972274 10:72182194-72182216 AAAACCAGTTAAGAAGTTGCAGG + Intronic
1070470682 10:76775982-76776004 CCAGGTAGTCAAGAATTTGCAGG - Intergenic
1070475811 10:76828004-76828026 TAAGTTGGGTAAGAAGTTGAAGG - Intergenic
1071574921 10:86718217-86718239 TTAGGAAGCCAAGAAGTTGCTGG + Intronic
1074323685 10:112427361-112427383 TAAGGTACTTAAGTACCTGCCGG + Exonic
1077773733 11:5249013-5249035 TATGGTCGTTAAAAAGATGCAGG - Intronic
1079630587 11:22669126-22669148 TAATGTAGTTAAGAACCAGCAGG - Intronic
1081517177 11:43844285-43844307 GAAAGAAGTTAAGAAGTTGAGGG - Intronic
1081856043 11:46304643-46304665 TAGGGTGGCTAAGGAGTTGCTGG - Intronic
1082703188 11:56459573-56459595 TATGGGAGTGAAGAAGCTGCTGG - Intergenic
1085885072 11:80512175-80512197 AAAGGCCCTTAAGAAGTTGCAGG - Intergenic
1086001166 11:81987232-81987254 AAAGGAAGTTAAGAAGAGGCAGG - Intergenic
1087523182 11:99270404-99270426 TAAGAAGGTTAAGAAGGTGCTGG - Intronic
1088559879 11:111103390-111103412 TAAAATTGTTAAGAACTTGCAGG + Intergenic
1090532358 11:127604321-127604343 TAATGTAGTTAAGAACCTACGGG + Intergenic
1091914545 12:4260893-4260915 TACGGAAGTTAAGACTTTGCAGG - Intergenic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1093126196 12:15331124-15331146 TAAGGAATTTAAGAAGTTGAAGG + Intronic
1093862085 12:24178355-24178377 TAACATAGTGAAGAAGTTCCAGG + Intergenic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1097575450 12:61387739-61387761 TAAAATAGTTAAGAAGTGGCAGG + Intergenic
1097937706 12:65272143-65272165 TATGGTAGGAAAAAAGTTGCCGG - Intergenic
1097946431 12:65373973-65373995 TAAGGTAGTCACTAAGTTGAAGG + Intronic
1101803436 12:108042583-108042605 TAAGTTTGTCAAGAAGTTGCTGG - Intergenic
1104621399 12:130315734-130315756 CTCGGTAGATAAGAAGTTGCAGG + Intergenic
1107743103 13:43474945-43474967 GAAGGAGGTAAAGAAGTTGCAGG + Intronic
1108886404 13:55189097-55189119 TAAACTAGTTAAAAAGATGCAGG - Intergenic
1109411431 13:61973922-61973944 TATGGGAGTGAAGAAGCTGCTGG + Intergenic
1112122958 13:96433457-96433479 TATGGTAGTGAATAAGTTTCAGG + Intronic
1113355053 13:109571055-109571077 GAAGGTAATTAAGCAATTGCTGG - Intergenic
1113742492 13:112721214-112721236 TTAGGAATTTAGGAAGTTGCTGG + Intronic
1114914485 14:27245962-27245984 TAAGGTTGATAAGATGTTGCAGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121498371 14:94413555-94413577 TATGGGAGTTAAGAAGATGTGGG - Intergenic
1124506069 15:30275114-30275136 TTAGTTAGTAAAGAAGTGGCAGG + Intergenic
1124737484 15:32263518-32263540 TTAGTTAGTAAAGAAGTGGCAGG - Intergenic
1129515209 15:76153089-76153111 TCAGGTGGTTAGGAAGCTGCAGG - Intronic
1129899569 15:79136087-79136109 GAAGGAAGTTAGGAAGTTGGAGG - Intergenic
1133568478 16:7018191-7018213 TCAGGTAGTTACTAACTTGCAGG - Intronic
1133992702 16:10721622-10721644 CTCGGTAGATAAGAAGTTGCGGG + Intergenic
1136000156 16:27286363-27286385 TAAGGTAGGTAAGAAGTGACTGG + Intronic
1136928059 16:34393557-34393579 TATGGTAGTTAACAAGGAGCTGG - Intergenic
1136976515 16:35018249-35018271 TATGGTAGTTAACAAGGAGCTGG + Intergenic
1140000472 16:71020166-71020188 TAAGGTACCTCAGGAGTTGCCGG + Exonic
1203143839 16_KI270728v1_random:1786553-1786575 TCAGGTAAGTAAGAAATTGCAGG - Intergenic
1147776845 17:42907887-42907909 TAAGGTAGTGAAGTAGCAGCAGG + Intronic
1150991095 17:70260277-70260299 TAAGGATGTGAAGAAGTTGGAGG + Intergenic
1150991800 17:70268444-70268466 TAAGGGTGTTAAGAACCTGCAGG - Intergenic
1154062775 18:11078986-11079008 TACGGTAGTTAAAAAATTGCTGG + Intronic
1154108059 18:11541507-11541529 TAAGGTAAATAACAAGTTCCAGG - Intergenic
1156687228 18:39664857-39664879 TAAGGTGGTGAAGAAGTTTTGGG - Intergenic
1157083757 18:44555944-44555966 TGAAGTAGTTCAGAAGTGGCTGG + Intergenic
928981142 2:37136208-37136230 TAAGGAAGTTAAGGAGTTAAGGG - Intronic
929285915 2:40135221-40135243 TAAGTTAAATAAGAAGTTACTGG + Intronic
929769693 2:44881185-44881207 TAAGGGATTTAAGATGTTACAGG + Intergenic
931442632 2:62301796-62301818 TAAAGTAGTTAAGAAGATGTTGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932695888 2:73956092-73956114 TAAGGCAGTTGAGAAGTAGGAGG + Intronic
936524136 2:113231539-113231561 TGAAGTAGTGAAGGAGTTGCAGG + Intronic
937382950 2:121397716-121397738 AAAGCTAGTTGAGAAGTTGATGG - Intronic
939510736 2:143101377-143101399 TAAGGCAGCTACGAAGTAGCTGG - Intronic
939560911 2:143730545-143730567 TAAGCCACTTAGGAAGTTGCTGG + Intronic
943505004 2:188743903-188743925 TAATGTAGATAACAAGTTGATGG + Intronic
943570425 2:189567196-189567218 TGTGGTAGTGAAGAAGTTGGTGG + Intronic
945134275 2:206609826-206609848 AAAGGCAGTTAAGCAGTTTCAGG - Intronic
945724887 2:213463858-213463880 TATGGGAGTGAAGAAGCTGCTGG - Intronic
1169595868 20:7197507-7197529 TTAAGTAGATAAGAAGTTACTGG + Intergenic
1169998953 20:11593287-11593309 GTAGGTAATTAAGAAGATGCAGG + Intergenic
1171176680 20:23055829-23055851 TAAAGGAGTTCAGCAGTTGCAGG + Intergenic
1175244099 20:57571173-57571195 GAAAGTAGTTTAGGAGTTGCCGG + Intergenic
1175357003 20:58376411-58376433 TAATGTAATTAAGAATTTGAGGG - Intergenic
1175395283 20:58653488-58653510 TCAGTTAATTAAGAAGTTGAAGG + Intronic
1178934234 21:36847461-36847483 TAGGATAGTAAATAAGTTGCTGG - Intronic
1183881211 22:40832160-40832182 TGTGGAAGTTAAGAAGTTTCAGG - Intronic
950146834 3:10656156-10656178 AAAGGTGGTGAGGAAGTTGCTGG + Intronic
953056360 3:39390556-39390578 TAAGGTAGATGAGAAATAGCTGG - Intronic
953113198 3:39964306-39964328 TATAGCAGGTAAGAAGTTGCTGG + Intronic
953457524 3:43054736-43054758 TAAGGTACTAAAGAATTTTCTGG + Intronic
954488116 3:50873525-50873547 TAGGGTAGCTAAGAAAGTGCTGG - Intronic
958474242 3:94560569-94560591 TATGGTACTTATGAAGTTGTGGG - Intergenic
959149182 3:102588134-102588156 TAAGGTAATTAAGAAATTAAGGG + Intergenic
963340739 3:144029436-144029458 AAAAGTTGTTAAGAAGTTGGGGG - Intronic
964705223 3:159611271-159611293 TGAGATAGTTGAGAAGTTGTAGG + Intronic
965238463 3:166159938-166159960 CTTGGTAGATAAGAAGTTGCGGG + Intergenic
966234122 3:177681912-177681934 CCAGGTAGCTAAGAAGTAGCAGG + Intergenic
970377412 4:15473303-15473325 TAAGGTAGTTAGGGAATTCCAGG + Intronic
972019692 4:34295992-34296014 TAAGCTAGTTATAAAGATGCTGG - Intergenic
974523021 4:63010050-63010072 AAAGCTAGTTTAGAAATTGCTGG + Intergenic
977517381 4:98037731-98037753 TAAGCAAGTTAAAGAGTTGCTGG + Intronic
977957857 4:103051121-103051143 TAGGGGAGTTGAGAAGTTTCTGG + Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979636362 4:122958852-122958874 TAAGGGAGTTAGGAAGCTGGAGG + Intronic
980511564 4:133796828-133796850 TAAGGGAATTAAAATGTTGCTGG - Intergenic
982442649 4:155454971-155454993 CTTGGTAGGTAAGAAGTTGCAGG + Intergenic
984105165 4:175536139-175536161 TAATATAGTTTAGAAGTAGCTGG + Intergenic
990644180 5:57825126-57825148 TAAAGTAGAAAAGCAGTTGCTGG + Intergenic
990768823 5:59219795-59219817 AAGGGAATTTAAGAAGTTGCAGG + Intronic
992652866 5:78877897-78877919 TCAGGAAGTTAAGTAGTTACAGG + Intronic
992920775 5:81516785-81516807 TAAGGTAAATAAGAAGTTTTTGG + Intronic
995442244 5:112204927-112204949 TAAAGTAGCTAGGAAGTGGCAGG + Intronic
995512611 5:112923541-112923563 TCAGGCAGATAGGAAGTTGCTGG - Intergenic
996847947 5:127921296-127921318 CAAGGTAGTTAAGTAGTTTGGGG + Intergenic
1000683739 5:164220813-164220835 TTAGGTCATTAAGAAGCTGCTGG + Intergenic
1001205639 5:169760175-169760197 GAACGTAGTTAAGAAGTAGAAGG - Intronic
1001370976 5:171201202-171201224 CAGGGTCGTTAAGAACTTGCTGG - Intronic
1003965787 6:11250888-11250910 AAAGGTAGTAAGGAATTTGCAGG - Intronic
1004672337 6:17809371-17809393 TAAGGTAGTTCTGCAGTAGCAGG + Intronic
1006572435 6:35016896-35016918 TAAGGAATTCCAGAAGTTGCAGG + Intronic
1009532557 6:64839460-64839482 TAAGCTTATTAAAAAGTTGCCGG + Intronic
1009698409 6:67141940-67141962 TAACATAGGCAAGAAGTTGCAGG + Intergenic
1010635234 6:78250921-78250943 TAAAGTGGTAAAGAAGTTGGAGG - Intergenic
1013061921 6:106643016-106643038 TACAGTAGTTCAGAAGTTGTTGG + Exonic
1014282945 6:119462139-119462161 TAAGGTAAAGAAGAAGTTGGTGG + Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015314157 6:131798035-131798057 TAAGATGGTTAAGAAGGGGCTGG - Intergenic
1017284447 6:152658277-152658299 TAAGGTTGTTCTGAGGTTGCAGG + Intergenic
1019005439 6:168792806-168792828 TAAAGTAGATATGAAGTTCCCGG - Intergenic
1020778860 7:12493282-12493304 TAAAGTAGATTAAAAGTTGCTGG + Intergenic
1023090599 7:36614414-36614436 TAAGATTGTTAAGAAGTTCAAGG - Intronic
1024177588 7:46856817-46856839 TAAGGTAGCTAAGATGTAGAGGG + Intergenic
1028607415 7:92670119-92670141 TTAGGCAGCTAAGAAGTAGCAGG - Intronic
1028957115 7:96706042-96706064 TTAAGTAGTCAAGAAGTTGGAGG + Intronic
1031337764 7:120557650-120557672 TAATGTAGTAAAAAAGTTGTTGG - Intronic
1038573969 8:28687887-28687909 TAACGAATTTAGGAAGTTGCTGG + Intronic
1042134695 8:65621833-65621855 TAAGAAAGTTAAGATGGTGCTGG - Intronic
1042717964 8:71795504-71795526 AAATGTAGTTAAGAGGTTGGGGG + Intergenic
1044759810 8:95506456-95506478 TCAGGTACCTCAGAAGTTGCTGG + Intergenic
1046081935 8:109379881-109379903 TAATGTAGTTAAGGAGGAGCTGG + Intronic
1046518280 8:115291959-115291981 GAAGTTAGTGAAGAAGTTGAAGG - Intergenic
1050387784 9:5109343-5109365 CTTGGTAGATAAGAAGTTGCAGG - Intronic
1050797579 9:9563361-9563383 TAAGGTAATTAAAAAGATACTGG - Intronic
1051962407 9:22783530-22783552 TAAGGAAGATAATAAGTTGATGG + Intergenic
1055168745 9:73228466-73228488 CATGGTAGTTAATAAGTTTCAGG + Intergenic
1185839674 X:3376903-3376925 TAAGGTCCTTAAAATGTTGCGGG - Intergenic
1186756691 X:12678986-12679008 AAATGTAGTTAGGAAGTTGGAGG - Intronic
1187541779 X:20203557-20203579 AAAAGTAGTTAAGAAGAGGCCGG - Intronic
1187979724 X:24743176-24743198 TAAATTAGTTAATTAGTTGCTGG + Intronic
1188226040 X:27598788-27598810 CAAGGTAGTTATGTTGTTGCAGG - Intronic
1188742285 X:33800615-33800637 TCAGGTAGCCAAGAGGTTGCAGG + Intergenic
1192205504 X:69093437-69093459 TATGTTAATGAAGAAGTTGCAGG + Intergenic
1192555451 X:72085449-72085471 ACAGGTGGTTAAGAAGGTGCAGG - Intergenic
1193738962 X:85194916-85194938 TAATGTAGTTGATGAGTTGCTGG + Intergenic
1193740073 X:85206330-85206352 TCAGGTAGTGAAAAAGTAGCTGG + Intergenic
1198650301 X:138855885-138855907 TAAGCCAGTTAAGAAGCAGCTGG - Intronic
1199829370 X:151534042-151534064 TAAGTCAGTTCAGAAATTGCAGG - Intergenic
1200297352 X:154934065-154934087 TAAGGTAGTGAAGAAAGGGCTGG + Intronic
1201594828 Y:15656726-15656748 TAAGGTATTTAAAATGTTGAAGG + Intergenic