ID: 1014734295

View in Genome Browser
Species Human (GRCh38)
Location 6:125074066-125074088
Sequence AGTCACCCACTGGAAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014734291_1014734295 -10 Left 1014734291 6:125074053-125074075 CCTGCCAAGTGTCAGTCACCCAC 0: 1
1: 1
2: 0
3: 8
4: 140
Right 1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG 0: 1
1: 0
2: 1
3: 24
4: 260
1014734290_1014734295 13 Left 1014734290 6:125074030-125074052 CCTCTCTGTAAGGCAGAAGCTTA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG 0: 1
1: 0
2: 1
3: 24
4: 260
1014734289_1014734295 17 Left 1014734289 6:125074026-125074048 CCAACCTCTCTGTAAGGCAGAAG 0: 1
1: 0
2: 0
3: 27
4: 366
Right 1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG 0: 1
1: 0
2: 1
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014734295 Original CRISPR AGTCACCCACTGGAAAGGAA TGG Intronic
901733435 1:11296821-11296843 AGTCATCCATAAGAAAGGAAAGG - Intergenic
903589538 1:24444064-24444086 TATCAGCCACTGGAAATGAAGGG + Intronic
904596900 1:31652472-31652494 AGGAACCCACTGGAAGGGAAAGG + Exonic
905116516 1:35645935-35645957 AGTCAATCACTGGCAAGGAGTGG - Intergenic
906902750 1:49854369-49854391 AGTTCCCCACTGCAAAGGAAAGG + Intronic
908400388 1:63767274-63767296 GGTCAACCACTGGACAGTAAGGG - Intergenic
909629711 1:77759269-77759291 AGTCACCCACTGAGAGGGACTGG + Intronic
909990935 1:82221954-82221976 CATCACCCAGTGGAAAAGAAAGG + Intergenic
910679170 1:89844395-89844417 AGGCACACACCGGAAAGGTAGGG + Intronic
911298301 1:96144187-96144209 AGCCACCCACTGCAAAGTGATGG + Intergenic
912725072 1:112051837-112051859 ACTCACCCTATGGAAAGGTAGGG + Intergenic
912734601 1:112139235-112139257 AGTTAGCTACTGGAAAGGTAAGG - Intergenic
913443870 1:118928800-118928822 AGTCAGGTACTGGAAAGGGATGG - Intronic
913945464 1:125158713-125158735 AGTCATCAAATGGAAACGAAAGG - Intergenic
913948158 1:143195548-143195570 AATCACCTAATGGAATGGAATGG + Intergenic
913950682 1:143227181-143227203 AATCATCGAATGGAAAGGAAAGG + Intergenic
913951055 1:143231942-143231964 AATCATCTAATGGAAAGGAATGG + Intergenic
913954042 1:143269507-143269529 AATCACCTAATGGAATGGAAAGG + Intergenic
915309795 1:155001269-155001291 AGCCACCTGCTGGAAAGGGAGGG + Intergenic
915490224 1:156246545-156246567 AGTCTCACACTGGAATGGGAGGG + Intronic
915839532 1:159203343-159203365 AGACACTCTCTGGAAAGGAAGGG - Intronic
918900031 1:190403336-190403358 ATTCACCCAGTAGAATGGAATGG - Intronic
919775651 1:201192434-201192456 AGTCCCACACAGGAGAGGAAGGG - Intronic
921849055 1:219915242-219915264 AGACACCCAGGGGAATGGAAAGG + Exonic
922288480 1:224190308-224190330 AGTCTTCCACTGGTAAGTAAAGG + Exonic
922607648 1:226900517-226900539 GGTCACCCGCTGAGAAGGAAGGG + Intronic
922622945 1:227004915-227004937 TGTCACCCACGGGACAGGAGGGG + Intronic
923984957 1:239371213-239371235 AGACACACACTGGGCAGGAAAGG - Intergenic
924078683 1:240369347-240369369 ACTAAAACACTGGAAAGGAATGG - Intronic
1063566296 10:7174436-7174458 AGTCAAACACTGGAAAAGCAGGG - Intronic
1063931354 10:11031465-11031487 AGATACCCAATGTAAAGGAAGGG + Intronic
1066739302 10:38505913-38505935 TGACACCGAATGGAAAGGAATGG + Intergenic
1066744086 10:38587931-38587953 AATCATCAAATGGAAAGGAATGG + Intergenic
1066744495 10:38593117-38593139 AGTCATCCAATGGAATCGAATGG + Intergenic
1066765536 10:38799228-38799250 AGTCGTCGACTGGAAGGGAATGG - Intergenic
1066949405 10:42100210-42100232 AGTCATCTAATGGAATGGAATGG + Intergenic
1066955583 10:42167568-42167590 AGTCATCCAATGGAATCGAATGG + Intergenic
1066955631 10:42168140-42168162 AATCACCCAATGGAATCGAATGG + Intergenic
1067242854 10:44510748-44510770 GGGCACCTACTGGAAAGGTAAGG + Intergenic
1068757017 10:60667687-60667709 ATGTACTCACTGGAAAGGAAAGG - Intronic
1068790403 10:61024508-61024530 AGACAGACTCTGGAAAGGAAGGG - Intergenic
1068842290 10:61629366-61629388 AGTCACACACTGGGGAAGAAGGG - Intergenic
1072566405 10:96620346-96620368 AGTTACCTGCTGGAAACGAAAGG + Exonic
1073465880 10:103694255-103694277 AGTCTGCCACTGGAAAGGCGGGG + Intronic
1073828096 10:107349078-107349100 AGTCACATAAAGGAAAGGAAGGG - Intergenic
1075217330 10:120547685-120547707 AGTCAACCTTTGGAAAGGTATGG - Intronic
1075837617 10:125468952-125468974 AGTTACCCACTGGACATGGATGG - Intergenic
1075926277 10:126254111-126254133 AGCCTCCCAAGGGAAAGGAAGGG - Intronic
1076297438 10:129397558-129397580 AGTCTCCCACAGGAGAGCAAGGG - Intergenic
1076516135 10:131045379-131045401 AGTATCCAACAGGAAAGGAAAGG + Intergenic
1080038632 11:27735720-27735742 AAGCACCCACTGGGAATGAATGG + Intergenic
1080320234 11:30999967-30999989 AGTCACCAACCAGAAAGAAAAGG + Intronic
1081419337 11:42854139-42854161 AGTCAACAACTGGAATGTAATGG + Intergenic
1081469081 11:43352954-43352976 TGTAACCAACTGGAGAGGAAAGG - Intergenic
1082094047 11:48112489-48112511 AGTCATTCACAGGAAAGGAGAGG - Intronic
1083022481 11:59521223-59521245 AGCCAGCTACAGGAAAGGAAGGG + Intergenic
1083839825 11:65298055-65298077 AGTTACCCACTGGACAGGACTGG - Exonic
1084029449 11:66472743-66472765 AGTCACCCAGTGGTAAGTGATGG - Intronic
1085835364 11:79950331-79950353 AGGCACCAACAGGAAAGCAAAGG + Intergenic
1087587706 11:100142904-100142926 AGTCAACCACCAGAAAGCAAAGG - Intronic
1088587962 11:111376751-111376773 AGTCACCCGATGGAAGGGCAGGG - Intronic
1088687131 11:112294164-112294186 ACACACCCACTGGAGAAGAATGG - Intergenic
1089333443 11:117706184-117706206 AGGCACCTACTGGAGAGGAGAGG - Intronic
1090672238 11:128956733-128956755 ACTCAGCCTTTGGAAAGGAAAGG - Intergenic
1092764826 12:11843091-11843113 AGGCACCCACTAGAAAGCCATGG + Intronic
1094412044 12:30176874-30176896 AGTCTCCAACTGGAAAGAAGTGG - Intergenic
1096590979 12:52659142-52659164 TGTCACCCACTAGAAAGGCCAGG + Intergenic
1097031550 12:56093750-56093772 CCTCTGCCACTGGAAAGGAAGGG - Exonic
1097394727 12:59059896-59059918 AGTCAACCACTGCAAAACAATGG + Intergenic
1099922296 12:88973851-88973873 AGTAACCAAATGGAAAGCAAGGG - Intergenic
1100260370 12:92927963-92927985 AGTCATCCAGTAGATAGGAAGGG - Intronic
1100897178 12:99196797-99196819 AGTGACCCAATGAAAAGAAAAGG + Intronic
1104753218 12:131252926-131252948 AGTCACAGCCTGGATAGGAAGGG - Intergenic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1105821030 13:24080989-24081011 TGTCATCCTCTGGTAAGGAAAGG + Intronic
1108664636 13:52617433-52617455 AGTTGCCCACCGGAAAGCAAAGG + Intergenic
1109240460 13:59880461-59880483 AGTCACAGACTGTAAAGGAAAGG + Intronic
1110546181 13:76758239-76758261 GGGCAGACACTGGAAAGGAAAGG - Intergenic
1112851850 13:103715759-103715781 AGTCTCCCACTGTAAAGTGAGGG - Intergenic
1115794303 14:36915943-36915965 AGTCACACACTGGAAGGACATGG + Intronic
1116619886 14:47187845-47187867 AGTCATCCCTAGGAAAGGAAGGG + Intronic
1116747328 14:48837255-48837277 ATTCACCCAAAGGAAAGGAAAGG - Intergenic
1118282046 14:64438269-64438291 AGACAGCCTCAGGAAAGGAATGG - Intronic
1121922270 14:97893012-97893034 AGTAAGGCACTGGAAAGGGAGGG + Intergenic
1122636635 14:103132702-103132724 AGTCACGCCCTGGAGAGGAAGGG - Intronic
1127556447 15:60092180-60092202 ATATACCCTCTGGAAAGGAAGGG - Intergenic
1128909039 15:71495369-71495391 AGTCTGCCCCAGGAAAGGAATGG + Intronic
1129687879 15:77696717-77696739 ACTCAGCCACTGGAAACGGAGGG - Intronic
1132633947 16:933749-933771 AGCCACCCAGTGGACAGGACAGG - Intronic
1133316833 16:4890136-4890158 AGGCACACACTGGCAAGGGAGGG - Intronic
1135651352 16:24209331-24209353 AGTCATCCACAGGAGAGGAATGG - Intronic
1136410998 16:30076949-30076971 AGTTACCCACAAGTAAGGAATGG + Intronic
1136473850 16:30499547-30499569 TGTCACCCACTGGACAGTGACGG - Intronic
1136904987 16:34080994-34081016 AATCACCTAATGGAAATGAATGG + Intergenic
1136906131 16:34095031-34095053 AGTCATCCAATGGAATCGAATGG - Intergenic
1136947024 16:34664715-34664737 AATCATCCAATGGAATGGAATGG - Intergenic
1136949772 16:34702296-34702318 AGTCACCGAATGGAGATGAAAGG - Intergenic
1136952060 16:34733248-34733270 AATCATCAAATGGAAAGGAAAGG - Intergenic
1136954037 16:34758989-34759011 AATCACCCAATGGAATTGAATGG - Intergenic
1136966432 16:34916697-34916719 AATCACCCAATGGAATTGAATGG - Intergenic
1136968820 16:34948055-34948077 AATCATCCAATGGAAATGAATGG - Intergenic
1137086470 16:36130561-36130583 AATCATCAAATGGAAAGGAAAGG - Intergenic
1137769501 16:51004648-51004670 AGGCATCCACTGGAAATGAAGGG - Intergenic
1138168736 16:54829317-54829339 AGACAACCTCTGCAAAGGAATGG - Intergenic
1138170933 16:54849173-54849195 AGTCAACCACTGGCAAATAAGGG - Intergenic
1140680294 16:77378283-77378305 TGTCACCCACTGGACAGCATTGG - Intronic
1141008081 16:80371861-80371883 AGTTGCCCACTGGAAAATAAAGG - Intergenic
1141372614 16:83501684-83501706 AGTCACCCACTGGAGAGCCAGGG + Intronic
1144280030 17:13716947-13716969 AGTCACCCACAGAAGTGGAAGGG + Intergenic
1144363313 17:14517664-14517686 AGTCACACACTAAAAAGGAGAGG + Intergenic
1144412947 17:15019277-15019299 AGTCACCCACTGGTAAGTGATGG + Intergenic
1145335849 17:21911873-21911895 TGTCATCCAATGGAATGGAATGG + Intergenic
1145338627 17:21934543-21934565 TGGCACCGAATGGAAAGGAATGG + Intergenic
1145704234 17:26857374-26857396 TGGCATCCAATGGAAAGGAATGG + Intergenic
1146284453 17:31565094-31565116 AGTCACCCACTTGACAGAGAAGG - Intergenic
1146671850 17:34743354-34743376 ACTCACCCACTGAAAGGCAAAGG + Intergenic
1146776630 17:35624383-35624405 AGCCACCACCTGGAAAAGAAGGG - Exonic
1149291829 17:55225125-55225147 TTTCTCCCTCTGGAAAGGAATGG + Intergenic
1149906296 17:60529207-60529229 AGTCTCCCTTTGGGAAGGAAAGG + Intergenic
1151248509 17:72815215-72815237 AATCACCCAGGGGAAGGGAAGGG + Intronic
1152023562 17:77794685-77794707 AGTCCCCCTTTGGAAGGGAATGG + Intergenic
1203197067 17_KI270729v1_random:242032-242054 AGATACCGACTGGAATGGAATGG + Intergenic
1203197500 17_KI270729v1_random:245613-245635 TGTCATCAAATGGAAAGGAATGG + Intergenic
1203206673 17_KI270730v1_random:42803-42825 AGATACCGACTGGAATGGAATGG + Intergenic
1203207105 17_KI270730v1_random:46384-46406 TGTCATCAAATGGAAAGGAATGG + Intergenic
1156315956 18:35968809-35968831 AGTCCCCTATGGGAAAGGAAGGG - Intergenic
1158720718 18:59922018-59922040 AGCCTCCCACTGGCAAAGAAGGG + Intergenic
1158894687 18:61901703-61901725 CTTCACCCACTGGGAAGGCAGGG - Intergenic
1162272626 19:9628854-9628876 AGTCACATACAGGAAAGAAAAGG + Intronic
1164473326 19:28554004-28554026 ATGAACCCACTGGAAAGGGAAGG + Intergenic
1167625131 19:50583049-50583071 AGTATCCAACTAGAAAGGAATGG - Intergenic
1168242035 19:55093225-55093247 AGTCACACCCTGGCAGGGAAAGG + Exonic
925420416 2:3705858-3705880 TGTCACCCACTGCAGAGGGAGGG + Intronic
925858682 2:8154455-8154477 AGCCATCCTCAGGAAAGGAAAGG + Intergenic
928200288 2:29243524-29243546 AGTCACCCCCGGAAAAGGAGTGG - Intronic
930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG + Intergenic
931675025 2:64686109-64686131 AATCAGCCATTGGAAAGGGAGGG - Intronic
931749889 2:65321057-65321079 AGACCCCCACTGGAGAGCAAGGG - Intronic
931792352 2:65675717-65675739 AATCAGCCACTGGAAGGGAGAGG - Intergenic
931808949 2:65835304-65835326 ATGCACTGACTGGAAAGGAAGGG + Intergenic
931943389 2:67277892-67277914 AATCACACGCTGGAAATGAATGG + Intergenic
932122873 2:69117815-69117837 AGTCACACACTAGTAAGAAAAGG + Intronic
932127388 2:69156393-69156415 AGGAAGCCAGTGGAAAGGAAAGG - Intronic
932943634 2:76200528-76200550 AGTCAGTCACTGGAAAGGTATGG + Intergenic
933731494 2:85459668-85459690 AGTCACTCACTGGAGGGCAATGG - Intergenic
934191736 2:89803944-89803966 AATCACCGAATGGAATGGAATGG + Intergenic
934253536 2:90385833-90385855 AATCATCGACTGGAAAAGAATGG + Intergenic
934254044 2:90392178-90392200 AATCATCGACTGGAAAAGAATGG + Intergenic
935706711 2:105863666-105863688 AGTTTCCCATTGGACAGGAAGGG - Intronic
936806823 2:116343648-116343670 AGTTACCCACAAGAAATGAAAGG - Intergenic
936904719 2:117524357-117524379 AATCACTCATTGGGAAGGAAAGG - Intergenic
938957792 2:136314809-136314831 AGACGCCTTCTGGAAAGGAAAGG - Intergenic
938961069 2:136342133-136342155 AGTGACCGAGTGGAAAAGAAGGG - Intergenic
939845653 2:147243263-147243285 AATTACCCACAGGAAAGGAGAGG - Intergenic
940139759 2:150481144-150481166 AGTCAACTTCTAGAAAGGAAGGG + Intronic
941697984 2:168573731-168573753 AGCCACCCACAGAGAAGGAAAGG - Intronic
947240186 2:227986185-227986207 AGAAACTCATTGGAAAGGAAGGG - Intronic
1169132886 20:3175914-3175936 AGTCTCCCTCTGGAATGCAATGG + Intergenic
1169585376 20:7077099-7077121 AGTCACACACTGAAAACAAATGG - Intergenic
1169761176 20:9096656-9096678 TGTCACCCACTGAAAAAGACAGG - Intronic
1170476092 20:16716073-16716095 TGTCACCCAGTGGAGAGCAATGG + Intergenic
1171931550 20:31233597-31233619 AGGTACCGAATGGAAAGGAATGG + Intergenic
1171988128 20:31675140-31675162 AGTCACCCAAGAGGAAGGAAGGG - Intronic
1173016853 20:39233806-39233828 AGACACCTCCTGCAAAGGAAAGG + Intergenic
1174191620 20:48744621-48744643 AGGCACCCACTGGACAGTAAGGG - Intronic
1175094328 20:56529475-56529497 TGTCACCCACTGGAGTGCAATGG - Intergenic
1176289099 21:5034842-5034864 AGTCACCCACAGGAAGGGACTGG + Intronic
1179868136 21:44228762-44228784 AGTCACCCACAGGAAGGGACTGG - Intronic
1180526004 22:16261570-16261592 AATCATCCAATGGAATGGAATGG - Intergenic
1180533810 22:16376422-16376444 AGTCATCCATTGGAATCGAATGG + Intergenic
1180533916 22:16378024-16378046 AGTCATCCAATGGAATCGAATGG + Intergenic
1180534056 22:16379900-16379922 AGTCACCAAATGGAACCGAATGG + Intergenic
1184779294 22:46638314-46638336 AGCCACCCACTGGGAATGCAAGG - Intronic
1184821248 22:46910623-46910645 AGTGACCCAGTGGAGAGGAGTGG + Intronic
1203315587 22_KI270737v1_random:5896-5918 AGTCACCAAATGGAACCGAATGG - Intergenic
1203315727 22_KI270737v1_random:7772-7794 AGTCATCCAATGGAATCGAATGG - Intergenic
1203315833 22_KI270737v1_random:9374-9396 AGTCATCCATTGGAATCGAATGG - Intergenic
1203320838 22_KI270737v1_random:58923-58945 AATCATCAAATGGAAAGGAAAGG + Intergenic
1203328598 22_KI270738v1_random:54986-55008 AATCATCAAATGGAAAGGAAAGG + Intergenic
1203330625 22_KI270738v1_random:81373-81395 AATCACCGAATGGAATGGAATGG + Intergenic
954770868 3:52967060-52967082 AGTAACCCACAGGAAAGCAGAGG + Intronic
956742211 3:72284165-72284187 TGTCTGCCACTGGCAAGGAAAGG + Intergenic
956766108 3:72485900-72485922 AGTCATGCACTGGGGAGGAAGGG + Intergenic
956798990 3:72739874-72739896 AGTCACTCACTGGGCAGGAATGG + Intergenic
959595996 3:108129014-108129036 AGTCCCACACTGGATAGAAATGG + Intergenic
960257205 3:115523438-115523460 AGTGACGCAAGGGAAAGGAAGGG - Intergenic
961560070 3:127722558-127722580 CGTGGCCAACTGGAAAGGAACGG + Exonic
962023409 3:131523985-131524007 AGTCACAAACAGGAATGGAATGG + Intergenic
962381478 3:134901649-134901671 AGTCATCCAGGGGAAAGGAATGG + Intronic
965493050 3:169363424-169363446 AGTCTCCCACTTAAAGGGAAAGG - Intronic
967084629 3:186082891-186082913 AGTGACTGACTGGAAAGGACAGG + Intronic
967378771 3:188834441-188834463 AGTCACCCAATGGAACGTCAAGG - Intronic
967731586 3:192912014-192912036 AATCAAACACTGGAAAGGTAGGG + Intronic
968940356 4:3634439-3634461 TCTCAGCCACTGGAAAGGTAGGG - Intergenic
969128585 4:4973709-4973731 ACTCACTCACTGGAAAAGTAAGG - Intergenic
969846253 4:9922616-9922638 GGTCCCCCACTGGACAGAAATGG - Intronic
969854303 4:9986621-9986643 TATGAGCCACTGGAAAGGAAAGG - Intronic
970904260 4:21197147-21197169 AGACACCCACTGCAATAGAATGG - Intronic
971129399 4:23789694-23789716 AGTCACCTAATGGTAAGTAATGG + Intronic
972571914 4:40318744-40318766 TGTCACCCACTGGAGTGCAATGG - Intergenic
974647543 4:64714690-64714712 AGAAAATCACTGGAAAGGAAAGG + Intergenic
975702741 4:77082262-77082284 CTTCAAACACTGGAAAGGAAGGG - Intergenic
976442019 4:85086967-85086989 AGTGACTTACTGGAAAGTAACGG - Intergenic
977637981 4:99322730-99322752 ATTCACCCAATAGAAAGCAAAGG + Intergenic
980828025 4:138095412-138095434 AGTCAGCCTCTGAAAAAGAAAGG + Intergenic
981347269 4:143690706-143690728 AGTCAGCCACTGTAAAGCAATGG + Intronic
982289636 4:153766639-153766661 AGCCACCCACTGCAAATGCATGG + Intergenic
982519780 4:156400466-156400488 AGTAACCCACTGTAATGGCAGGG - Intergenic
983025161 4:162727314-162727336 AGTCTCTGACTGGAAAGGACTGG + Intergenic
984827230 4:183937150-183937172 CGTGACTCACAGGAAAGGAAAGG - Intronic
987950745 5:24672669-24672691 AGTCACAGACTGAAAATGAAAGG - Intergenic
988633307 5:32954396-32954418 ACTGACCCATTGGAAAGCAAAGG + Intergenic
990715012 5:58627067-58627089 AGTCATCAACTGCACAGGAAAGG + Intronic
991448756 5:66729119-66729141 ACTGACCCATTTGAAAGGAAGGG + Intronic
992765681 5:79997055-79997077 AGTAACCCACAAGAAAGCAAGGG + Intronic
996253132 5:121363195-121363217 CTTAACCCACTGGAAAAGAAAGG + Intergenic
996524427 5:124462960-124462982 AGGCAGCCACTGGAATGGGAGGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997422532 5:133780506-133780528 GGTCTCCCACTGGACTGGAAGGG + Intergenic
1001399965 5:171440571-171440593 AGTCAGCCTCTAGTAAGGAATGG - Intronic
1002012553 5:176295348-176295370 AGTCACCCACTGTAACGGTTAGG - Intronic
1002098793 5:176847233-176847255 AGTCACGCGCTGGATGGGAACGG - Intronic
1002215261 5:177627274-177627296 AGTCACCCACTGTAACGGTTAGG + Intergenic
1007843225 6:44733679-44733701 AGTCACCCACTGCCAAGTTAGGG - Intergenic
1009897722 6:69774101-69774123 AGGGACCCAGTGGAAAGTAATGG + Intronic
1011844679 6:91548857-91548879 ATTCACCCACTTGAAAAGGAAGG + Intergenic
1012862111 6:104572258-104572280 TGTCACCCAGTCTAAAGGAAGGG + Intergenic
1013196650 6:107850046-107850068 AATCACCCACTGGAAAGGGAAGG - Intergenic
1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG + Intronic
1016402079 6:143691973-143691995 AGGCACACAATTGAAAGGAAAGG - Intronic
1017958919 6:159204898-159204920 AGTCACCTACTAGAAGTGAAAGG - Intronic
1018208949 6:161461598-161461620 AGTCAGCCACTGGAGATAAAAGG + Intronic
1020228291 7:6297291-6297313 AGTCACCCACTGGAGTGCAGTGG - Intergenic
1023759873 7:43455353-43455375 ATTCACCCACTCAAAAGGAAAGG + Intronic
1024376035 7:48639141-48639163 GATTACCCACTGGAAAGAAAAGG - Intronic
1024882985 7:54110972-54110994 AGTCTCCCAGTGCAGAGGAAAGG - Intergenic
1025316561 7:58038319-58038341 AATCATCCAATGGAATGGAATGG + Intergenic
1025317046 7:58044647-58044669 AATCACCCAATGGAATTGAATGG + Intergenic
1025483764 7:61020309-61020331 AATCACCCAATGGACAAGAATGG - Intergenic
1025483992 7:61023230-61023252 AATCACCAACTGGACACGAATGG - Intergenic
1025485264 7:61039421-61039443 AATCACCGACTGGACACGAATGG + Intergenic
1025555554 7:62303397-62303419 AATCACCTAATGGAAAAGAATGG + Intergenic
1026353254 7:69535716-69535738 AGTCACTCATTGAAAAGGATTGG + Intergenic
1030731157 7:112990836-112990858 ACTTAACCACTGGAAAGAAAAGG + Intergenic
1031673847 7:124585541-124585563 AGGAAAACACTGGAAAGGAAAGG - Intergenic
1034148597 7:148894459-148894481 GGTCACCCACTGGAAAGACAAGG + Intergenic
1034241314 7:149613281-149613303 AGTCACACACTGGAGAAGGAAGG - Intergenic
1036414569 8:8535198-8535220 AGGGACCCAGTGGAAGGGAATGG - Intergenic
1036656131 8:10678670-10678692 AGTCACCCACTGGGCAGAACTGG - Intronic
1038263756 8:26020543-26020565 AGACACCCACTAGAAATGCAGGG + Intronic
1041631060 8:60087473-60087495 AGTAACACATTGGAAAGGACAGG + Intergenic
1042766713 8:72330318-72330340 ACTCACCCATAGCAAAGGAAAGG - Intergenic
1045108271 8:98915036-98915058 AGACACCCACCTCAAAGGAAAGG + Intronic
1045559264 8:103245364-103245386 AGAAAACCACTGGATAGGAAAGG - Intergenic
1046676196 8:117111435-117111457 AGTGACCCAAAGGAAAGGTAGGG - Intronic
1046845695 8:118913203-118913225 AGGCACAGAGTGGAAAGGAAGGG - Intergenic
1048291334 8:133183815-133183837 AGTCCCCCACAGCAGAGGAAAGG + Intergenic
1048860594 8:138722069-138722091 AGGGACCCCCTGGAAAGGACGGG - Exonic
1051376024 9:16403876-16403898 AGTCTCCCACAGTTAAGGAAAGG + Intergenic
1054981880 9:71216544-71216566 AGACACACACAGGAAATGAAAGG + Intronic
1055511949 9:77003880-77003902 GGACAACCACTGGGAAGGAAGGG - Intergenic
1055790342 9:79916636-79916658 AGTCACACACTCAAAAGGAAAGG - Intergenic
1056997941 9:91480904-91480926 AGTTACCCACAGGAAAGGATGGG + Intergenic
1057950221 9:99363896-99363918 TGTCACTCACAGGAAAGAAAAGG - Intergenic
1059456188 9:114401751-114401773 AGGCAGCTTCTGGAAAGGAATGG + Intergenic
1060260355 9:122069245-122069267 AGTCTCCCACTGCACAGGTAGGG - Intronic
1061394971 9:130338680-130338702 AGTCATACACTGAAAAGGGAGGG + Intronic
1203390659 Un_KI270438v1:94422-94444 TGGCACCGAATGGAAAGGAATGG + Intergenic
1186780135 X:12903884-12903906 GGTCATCCACTCGAGAGGAAAGG + Intergenic
1186922525 X:14297832-14297854 ATTGACCCAATGGAAAAGAAGGG + Intergenic
1187261723 X:17690938-17690960 AGCCTCCAACTTGAAAGGAAAGG - Intronic
1190898309 X:54642603-54642625 AGCCAGCCACTGGAAAAGCAAGG - Intergenic
1192135139 X:68589739-68589761 AGTCATCAACTGAAAGGGAAGGG + Intergenic
1192789978 X:74371968-74371990 TGTCAGCCAGTGGAAAGAAATGG - Intergenic
1194344140 X:92741908-92741930 ATTGACTCACTGGAATGGAAGGG - Intergenic
1196887805 X:120264062-120264084 GGTCACCAAATGGATAGGAAAGG + Intronic
1198254733 X:134914974-134914996 AGTCACACACGGGACAGGAAAGG + Intronic
1198718421 X:139588075-139588097 AGTCACCTCATGGAAAGGACTGG + Intronic
1200652486 Y:5858562-5858584 ATTGACTCACTGGAAGGGAAGGG - Intergenic
1201195209 Y:11487284-11487306 AGTCATCCAATGGAATCGAATGG - Intergenic
1201195380 Y:11489593-11489615 AATCATCCAATGGAATGGAATGG - Intergenic
1201195416 Y:11490102-11490124 AATCATCCAATGGAATGGAATGG - Intergenic
1201201572 Y:11545131-11545153 AGACATGCAATGGAAAGGAATGG + Intergenic
1201209445 Y:11666121-11666143 AGTAATCCAATGGAAAGGAACGG + Intergenic
1201212470 Y:11693229-11693251 TGTCATCGAATGGAAAGGAATGG + Intergenic
1201532353 Y:15005867-15005889 ATTCACCCTCAGAAAAGGAAAGG + Intergenic