ID: 1014737704

View in Genome Browser
Species Human (GRCh38)
Location 6:125113276-125113298
Sequence CACAAGGGCCTGCAACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014737704_1014737709 2 Left 1014737704 6:125113276-125113298 CCATGGTGTTGCAGGCCCTTGTG No data
Right 1014737709 6:125113301-125113323 AACACAGTGGCACAACAGCAGGG No data
1014737704_1014737710 14 Left 1014737704 6:125113276-125113298 CCATGGTGTTGCAGGCCCTTGTG No data
Right 1014737710 6:125113313-125113335 CAACAGCAGGGCCTCAGCAATGG No data
1014737704_1014737708 1 Left 1014737704 6:125113276-125113298 CCATGGTGTTGCAGGCCCTTGTG No data
Right 1014737708 6:125113300-125113322 GAACACAGTGGCACAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014737704 Original CRISPR CACAAGGGCCTGCAACACCA TGG (reversed) Intergenic
No off target data available for this crispr