ID: 1014740236

View in Genome Browser
Species Human (GRCh38)
Location 6:125140719-125140741
Sequence GAGAAAAAGGAGAGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2135
Summary {0: 1, 1: 0, 2: 21, 3: 226, 4: 1887}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014740230_1014740236 20 Left 1014740230 6:125140676-125140698 CCATGGGGAAGAGAAATTCTGGT 0: 2
1: 28
2: 94
3: 188
4: 387
Right 1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG 0: 1
1: 0
2: 21
3: 226
4: 1887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014740236 Original CRISPR GAGAAAAAGGAGAGGGAGAC AGG Intronic
Too many off-targets to display for this crispr