ID: 1014747889

View in Genome Browser
Species Human (GRCh38)
Location 6:125221252-125221274
Sequence CAGACCCAGCTAAAGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014747889_1014747891 -5 Left 1014747889 6:125221252-125221274 CCTCAAATCTTTAGCTGGGTCTG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1014747891 6:125221270-125221292 GTCTGTCTGTGGCCACTGAGTGG 0: 1
1: 0
2: 3
3: 23
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014747889 Original CRISPR CAGACCCAGCTAAAGATTTG AGG (reversed) Intronic
900990071 1:6094551-6094573 CAGACCCCGCCAGAGCTTTGGGG - Intronic
902977989 1:20102810-20102832 CTGGCCCAGCAAAAGAGTTGGGG + Intergenic
904032796 1:27543636-27543658 CAGACCCAGCAAGAGTTGTGGGG + Intronic
905150030 1:35920115-35920137 CAGACCCAGATCAATATTTTAGG + Exonic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
908959612 1:69680026-69680048 AAGACCCAGGTAAATATTTTAGG - Intronic
910895990 1:92070057-92070079 CATACCCAGCTAAACATTTGAGG - Intergenic
912945893 1:114083864-114083886 CAGGAGCAGCTAAAGAGTTGTGG - Intergenic
914334933 1:146705546-146705568 CAGCCCTAGCTACAGATGTGAGG - Intergenic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
920687326 1:208119341-208119363 CAGACCCAGCGAAAGGTGTCCGG + Intronic
924450214 1:244171762-244171784 CAGACCCAGCCACAGCTTAGAGG + Intergenic
1063164466 10:3447382-3447404 CAGCTCCAGCCAAAGATTTGAGG - Intergenic
1067742167 10:48903928-48903950 CAGAGCCAGCTGAAGAGATGGGG + Intronic
1068691975 10:59925884-59925906 CAGACCCACCTAAATATTTCAGG - Intergenic
1069517561 10:69090746-69090768 CAAACCCAAGTAAAGATGTGGGG + Intronic
1069950361 10:72014468-72014490 GAGACACAGGTTAAGATTTGGGG - Intergenic
1071503974 10:86222000-86222022 CAGAGCCAGCTAAAGCATGGGGG + Intronic
1071664223 10:87538189-87538211 CAGTGCCAGCTGAAAATTTGAGG + Intronic
1072788262 10:98299449-98299471 CAGACCCAGCTCAAGGTCTGAGG + Intergenic
1073712587 10:106061514-106061536 CAAAGCCAGCTAAAGATTCCTGG - Intergenic
1074456663 10:113601433-113601455 CAGAACCAGCTGAACATTTCAGG + Intronic
1078984511 11:16579550-16579572 GAGAAACAGCTAAAGATTAGAGG - Intronic
1079397924 11:20081990-20082012 CAGATCCATCTCATGATTTGGGG + Intronic
1081830236 11:46104456-46104478 CAGAGCCTGCTAAATATTTTAGG - Intronic
1084054782 11:66625278-66625300 CAGACCCAGCTGAATAGTTACGG + Exonic
1089193640 11:116677241-116677263 CACACCCAGCTAAATTTTTTTGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1090609579 11:128458276-128458298 CAGCCCCAGTGAAAGAGTTGGGG + Intergenic
1093733992 12:22598109-22598131 CACACCAAGCAAAAAATTTGAGG + Intergenic
1097964701 12:65566367-65566389 GAGACCCTGCTAAGAATTTGGGG - Intergenic
1098488146 12:71045616-71045638 CAGCCCCAGCTATGAATTTGAGG + Intergenic
1099353177 12:81599394-81599416 GAGTCCCATCTAAAGAATTGAGG - Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100871988 12:98919527-98919549 CAGACCCAGCTTAAGAACTGAGG - Intronic
1101342167 12:103852532-103852554 CAGGCCCAGTCAAAGATCTGGGG - Intergenic
1102018347 12:109663548-109663570 CAGACCCAGCTTAAGGGGTGTGG - Intergenic
1102851153 12:116246656-116246678 CAGACACAGCTGAAGCATTGTGG + Intronic
1103147038 12:118603792-118603814 CAGCCACAGCTACAGATCTGTGG + Intergenic
1107378732 13:39832880-39832902 GAGAACTAGCTAAAGACTTGAGG - Intergenic
1109208530 13:59508482-59508504 CTGCCCCAGTGAAAGATTTGGGG - Intergenic
1109233081 13:59782841-59782863 AAGACCCAGCTAAAGCTGTCAGG + Intronic
1110720427 13:78754955-78754977 CCGACCCATATAAAGGTTTGAGG + Intergenic
1111184971 13:84721717-84721739 CTGACACAGCTAAATATTTCAGG + Intergenic
1111297484 13:86300935-86300957 CAGAATCAAATAAAGATTTGTGG + Intergenic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1126368643 15:47922421-47922443 CAGACACAGATATAGAGTTGAGG - Intergenic
1126735727 15:51730357-51730379 CACACCCAGCTAAATGTTTTGGG - Intronic
1129345270 15:74913759-74913781 CAAATCCAGCTAAACATTTTTGG - Intergenic
1131572123 15:93549440-93549462 CAGACCAAGCATAAAATTTGAGG - Intergenic
1131600996 15:93848671-93848693 CAGACACAGCTGAACATTTAAGG - Intergenic
1133662660 16:7933966-7933988 CAGACCTATCTAATGATTTTTGG + Intergenic
1137734360 16:50713024-50713046 GAGCCCCAGCCAAAGATGTGAGG + Intronic
1139998690 16:71005690-71005712 CAGCCCTAGCTACAGATGTGAGG + Intronic
1140890437 16:79280291-79280313 CAGACTCACCTCAACATTTGTGG + Intergenic
1146711859 17:35048839-35048861 CAAACCAAGCTAAAGGTCTGTGG - Intronic
1147949090 17:44097092-44097114 CAGACCCATCTAAACAGGTGTGG - Intronic
1148832273 17:50441325-50441347 CACACCCAGCTAAATTTTTTTGG + Intronic
1151843477 17:76634433-76634455 CAGGCCCAGCTAACAATGTGGGG - Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1155203419 18:23536983-23537005 CAGACCCAGCTGTACATTTCAGG + Intronic
1156556922 18:38078300-38078322 CAGCCTCAGCTAAAGCTTGGAGG - Intergenic
1158264853 18:55650824-55650846 AAGACTTAGCTAAAGATTTCAGG - Intronic
1158313187 18:56181373-56181395 GAGACCCTACTAAGGATTTGTGG - Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1165491114 19:36123415-36123437 CACCCCCGGCTAAAGTTTTGTGG + Intronic
1166851511 19:45763648-45763670 CAGAGACAGCAAAAGAATTGAGG - Intronic
925749083 2:7071276-7071298 CAGAGCCAGCTGCAGATGTGTGG + Intergenic
927565693 2:24110770-24110792 CTGACCTGGCTACAGATTTGGGG - Intronic
930752364 2:54945810-54945832 TAGACTCAACTAAAGATGTGGGG - Intronic
932381460 2:71287457-71287479 AAGACCCAGCCAAAGATGGGAGG + Intronic
933076872 2:77939841-77939863 CAGAACCAGTTAAAGAGCTGTGG - Intergenic
933128856 2:78647400-78647422 CTGACCCAGATAAGGATTTTGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937536194 2:122890908-122890930 CAAACCCTTCTAAAGAGTTGAGG + Intergenic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
1169432589 20:5552025-5552047 AAGAGCCAAATAAAGATTTGAGG + Intronic
1170383819 20:15794412-15794434 CTGCCCCAGCTGAAGATATGAGG - Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1176061817 20:63175854-63175876 GAGACCCAAAGAAAGATTTGGGG + Intergenic
1178181937 21:30171549-30171571 CAAAGCCAGTTAAAGATTTTCGG + Intergenic
1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG + Intronic
1179474796 21:41636295-41636317 CATACCCAGATAAAGAATTTAGG + Intergenic
1179900177 21:44388063-44388085 CAGACCCTGCTTTAAATTTGGGG - Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1183410119 22:37650088-37650110 CAGAGCCAGCCAGAGAGTTGGGG + Intronic
950774383 3:15337047-15337069 CACACTCAGCCAAAGAGTTGGGG + Intronic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
953309403 3:41862830-41862852 CTGAGCCACCTAAAGACTTGGGG + Intronic
953541424 3:43821732-43821754 CAGACCCTTCAAAAGATTTCAGG - Intergenic
954919770 3:54179930-54179952 CAGACCCTGCTGAAGAATTTTGG - Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
962923724 3:139973382-139973404 GAAACCCAGCTAAAAATTGGAGG + Intronic
964840873 3:160992242-160992264 CTGATCAAGCTAAATATTTGTGG + Intronic
965895466 3:173570479-173570501 CTCACCCAGTTAAAGATTTCAGG - Intronic
966097159 3:176217850-176217872 CAGAGACAGCTAAGAATTTGGGG + Intergenic
967279748 3:187810459-187810481 AAGCCCCAGCTGAACATTTGAGG - Intergenic
968085620 3:195872672-195872694 CTGACCCACCTAGAGAGTTGTGG - Intronic
968429409 4:546854-546876 CACACCCAGCTAAATATTTAGGG + Intergenic
969508174 4:7601460-7601482 CATACCCAGCTAAACATATGAGG - Intronic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
975331955 4:73126217-73126239 AAAACTCAGCTGAAGATTTGAGG - Intronic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
977113904 4:92996478-92996500 CAGACCCAGACACAGATTTGAGG - Intronic
981637568 4:146898256-146898278 CAGACCCAGCAACAGACTTCTGG - Intronic
983641831 4:169950500-169950522 TGGGCCCTGCTAAAGATTTGTGG - Intergenic
985415014 4:189727057-189727079 TAGACCAAGCTGAGGATTTGGGG - Intergenic
992015096 5:72567474-72567496 CAGACCCAGAGAGAGATTTGGGG + Intergenic
993421175 5:87702417-87702439 TCAACCCAGCTAAAGATTTTAGG + Intergenic
993750622 5:91662093-91662115 CAAACCCAGATAAAGAGTTGTGG + Intergenic
993809920 5:92463537-92463559 CACACCCAGCTAAATGTTTCTGG - Intergenic
996852190 5:127965585-127965607 AAGAACAAGGTAAAGATTTGAGG + Intergenic
1000250604 5:159491366-159491388 CAGATCCATGTTAAGATTTGTGG + Intergenic
1000663355 5:163963700-163963722 CAGACACAGTTAAACATTTAGGG + Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1003701100 6:8466217-8466239 AAGACCCAACTAAAGTTATGAGG + Intergenic
1003841284 6:10123076-10123098 CAGAGACAGCTAAAGAGTTGTGG + Intronic
1004040021 6:11966174-11966196 CAGAGACAGCTCAAGTTTTGTGG + Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1006256567 6:32837482-32837504 AAGACCCCTATAAAGATTTGGGG + Intronic
1007323815 6:41045333-41045355 CTGACCTTGTTAAAGATTTGAGG - Intronic
1008900495 6:56609211-56609233 GAGACACAGCTAATGATTTCTGG - Intronic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1014747889 6:125221252-125221274 CAGACCCAGCTAAAGATTTGAGG - Intronic
1018797784 6:167200763-167200785 CTGACCCAGGGAGAGATTTGGGG - Intergenic
1021055970 7:16046770-16046792 CAGACACTGCTCTAGATTTGTGG + Intergenic
1023788875 7:43736307-43736329 TAGTCCCAGCTACAGATGTGAGG + Intergenic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1026340612 7:69430935-69430957 CAGAGAGAGCTAAAGATTAGTGG + Intergenic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1030903663 7:115155469-115155491 TATACCCACCTAAAGACTTGAGG - Intergenic
1032588713 7:133172578-133172600 CAGACCCATTTAAATCTTTGAGG + Intergenic
1033036025 7:137876993-137877015 CAGACCCAGCAAAAGCGTAGAGG - Exonic
1033706222 7:143887010-143887032 TAGAACCAGCTCAAAATTTGAGG - Intronic
1037358185 8:18045264-18045286 CAGAGGCAGCTAAAGATTACAGG - Intergenic
1038587256 8:28801103-28801125 CAGAAACAGCAAAACATTTGGGG + Intronic
1040640580 8:49329706-49329728 CACACCCTGCTAAAGGTGTGAGG - Intergenic
1047071365 8:121347559-121347581 CAGACTGAGTTAAAGGTTTGGGG - Intergenic
1047991340 8:130289729-130289751 CAGCCCCAGCTAAAGGATTGTGG - Intronic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1049303542 8:141884602-141884624 CATACCCAGCTAACAATTAGGGG - Intergenic
1051164473 9:14247337-14247359 CAGATCCAGCTAATGGTTGGAGG + Intronic
1051977570 9:22970604-22970626 CAGACCCAGTCAAACATATGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053119156 9:35532587-35532609 CACACCCAGCTATATTTTTGTGG - Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055396439 9:75880144-75880166 CGCACCCAGCTGAAGATATGTGG - Intergenic
1056768463 9:89459799-89459821 AAGACCCAGGCTAAGATTTGAGG + Intronic
1056984270 9:91346787-91346809 AACAACCAGCTATAGATTTGGGG + Intronic
1058728136 9:107823346-107823368 TGGTCCCAGCTAAAGATATGTGG - Intergenic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1061267884 9:129518599-129518621 CAGAGTCAGCCAAAGATTTAAGG + Intergenic
1186405471 X:9298217-9298239 CAGAGCCAGCCTAACATTTGGGG - Intergenic
1190381240 X:49841375-49841397 CAGACCCTAGTAAAAATTTGGGG - Intergenic
1193833724 X:86317424-86317446 GAGACACAGCTGGAGATTTGTGG + Intronic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1195272841 X:103250428-103250450 CAGGCCCAGCTCACGACTTGGGG - Intergenic
1196910003 X:120475599-120475621 CAGACAGATCTAGAGATTTGAGG - Intergenic
1198419609 X:136457199-136457221 CAGAGCCAGATAAATATTTTTGG + Intergenic
1200165400 X:154031975-154031997 CATCCCCAGATAAAGACTTGAGG + Intronic
1200343124 X:155420717-155420739 CAGACATAGCCAACGATTTGGGG + Intergenic
1200836516 Y:7737566-7737588 AAAAGCCAGCTAAAGATCTGTGG - Intergenic