ID: 1014749525

View in Genome Browser
Species Human (GRCh38)
Location 6:125239402-125239424
Sequence CAATTATGGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9645
Summary {0: 2, 1: 115, 2: 1512, 3: 2779, 4: 5237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014749520_1014749525 -1 Left 1014749520 6:125239380-125239402 CCACATGGCTGGGAATGCCTCAC 0: 1
1: 194
2: 3582
3: 7020
4: 7191
Right 1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG 0: 2
1: 115
2: 1512
3: 2779
4: 5237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014749525 Original CRISPR CAATTATGGCAGAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr