ID: 1014758177

View in Genome Browser
Species Human (GRCh38)
Location 6:125325030-125325052
Sequence AAATCTCCACGGGTGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014758174_1014758177 10 Left 1014758174 6:125324997-125325019 CCAAACTTTCATCTGAAATGTTC No data
Right 1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG No data
1014758173_1014758177 11 Left 1014758173 6:125324996-125325018 CCCAAACTTTCATCTGAAATGTT No data
Right 1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG No data
1014758172_1014758177 20 Left 1014758172 6:125324987-125325009 CCTTTATTTCCCAAACTTTCATC No data
Right 1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG No data
1014758171_1014758177 28 Left 1014758171 6:125324979-125325001 CCTTTCTGCCTTTATTTCCCAAA No data
Right 1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014758177 Original CRISPR AAATCTCCACGGGTGAAGCA AGG Intergenic
No off target data available for this crispr