ID: 1014767264

View in Genome Browser
Species Human (GRCh38)
Location 6:125421307-125421329
Sequence CTGAATATATAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014767264_1014767268 -10 Left 1014767264 6:125421307-125421329 CCATTGTCCATTTATATATTCAG No data
Right 1014767268 6:125421320-125421342 ATATATTCAGTCCCCTTGGTGGG No data
1014767264_1014767269 -9 Left 1014767264 6:125421307-125421329 CCATTGTCCATTTATATATTCAG No data
Right 1014767269 6:125421321-125421343 TATATTCAGTCCCCTTGGTGGGG No data
1014767264_1014767273 20 Left 1014767264 6:125421307-125421329 CCATTGTCCATTTATATATTCAG No data
Right 1014767273 6:125421350-125421372 AGATGCTGTGCCTCCACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014767264 Original CRISPR CTGAATATATAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr