ID: 1014769699

View in Genome Browser
Species Human (GRCh38)
Location 6:125446612-125446634
Sequence ATTAGCAAGTAGGAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014769699_1014769703 3 Left 1014769699 6:125446612-125446634 CCATCACACTCCTACTTGCTAAT No data
Right 1014769703 6:125446638-125446660 TCCAACTTGTCTTAGGCCACTGG No data
1014769699_1014769701 -4 Left 1014769699 6:125446612-125446634 CCATCACACTCCTACTTGCTAAT No data
Right 1014769701 6:125446631-125446653 TAATTCCTCCAACTTGTCTTAGG No data
1014769699_1014769705 4 Left 1014769699 6:125446612-125446634 CCATCACACTCCTACTTGCTAAT No data
Right 1014769705 6:125446639-125446661 CCAACTTGTCTTAGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014769699 Original CRISPR ATTAGCAAGTAGGAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr