ID: 1014769699 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:125446612-125446634 |
| Sequence | ATTAGCAAGTAGGAGTGTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014769699_1014769703 | 3 | Left | 1014769699 | 6:125446612-125446634 | CCATCACACTCCTACTTGCTAAT | No data | ||
| Right | 1014769703 | 6:125446638-125446660 | TCCAACTTGTCTTAGGCCACTGG | No data | ||||
| 1014769699_1014769701 | -4 | Left | 1014769699 | 6:125446612-125446634 | CCATCACACTCCTACTTGCTAAT | No data | ||
| Right | 1014769701 | 6:125446631-125446653 | TAATTCCTCCAACTTGTCTTAGG | No data | ||||
| 1014769699_1014769705 | 4 | Left | 1014769699 | 6:125446612-125446634 | CCATCACACTCCTACTTGCTAAT | No data | ||
| Right | 1014769705 | 6:125446639-125446661 | CCAACTTGTCTTAGGCCACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014769699 | Original CRISPR | ATTAGCAAGTAGGAGTGTGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||