ID: 1014770707

View in Genome Browser
Species Human (GRCh38)
Location 6:125454924-125454946
Sequence CAGGGCCAGTTGATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014770707_1014770712 -4 Left 1014770707 6:125454924-125454946 CCCCAAAACATCAACTGGCCCTG No data
Right 1014770712 6:125454943-125454965 CCTGAAGCCCCATCGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014770707 Original CRISPR CAGGGCCAGTTGATGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr