ID: 1014778878

View in Genome Browser
Species Human (GRCh38)
Location 6:125540765-125540787
Sequence AGTGTTAAATAAATAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014778878_1014778883 14 Left 1014778878 6:125540765-125540787 CCCTTATTTATTTATTTAACACT No data
Right 1014778883 6:125540802-125540824 TGGAGTACGGTTTCATATCTAGG No data
1014778878_1014778880 -6 Left 1014778878 6:125540765-125540787 CCCTTATTTATTTATTTAACACT No data
Right 1014778880 6:125540782-125540804 AACACTTATGCCTTAACTGCTGG No data
1014778878_1014778881 1 Left 1014778878 6:125540765-125540787 CCCTTATTTATTTATTTAACACT No data
Right 1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014778878 Original CRISPR AGTGTTAAATAAATAAATAA GGG (reversed) Intergenic
No off target data available for this crispr