ID: 1014778881

View in Genome Browser
Species Human (GRCh38)
Location 6:125540789-125540811
Sequence ATGCCTTAACTGCTGGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014778878_1014778881 1 Left 1014778878 6:125540765-125540787 CCCTTATTTATTTATTTAACACT No data
Right 1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG No data
1014778879_1014778881 0 Left 1014778879 6:125540766-125540788 CCTTATTTATTTATTTAACACTT No data
Right 1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG No data
1014778876_1014778881 14 Left 1014778876 6:125540752-125540774 CCACTATGCCAAACCCTTATTTA No data
Right 1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG No data
1014778877_1014778881 6 Left 1014778877 6:125540760-125540782 CCAAACCCTTATTTATTTATTTA No data
Right 1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014778881 Original CRISPR ATGCCTTAACTGCTGGAGTA CGG Intergenic
No off target data available for this crispr