ID: 1014786114

View in Genome Browser
Species Human (GRCh38)
Location 6:125621416-125621438
Sequence CCTGATAAACTGTAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014786114_1014786119 0 Left 1014786114 6:125621416-125621438 CCTTCCACTTACAGTTTATCAGG No data
Right 1014786119 6:125621439-125621461 GAAGGAAAAATATATAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014786114 Original CRISPR CCTGATAAACTGTAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr