ID: 1014787464

View in Genome Browser
Species Human (GRCh38)
Location 6:125634928-125634950
Sequence GATTATGGACAAGGGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014787464_1014787471 -8 Left 1014787464 6:125634928-125634950 CCCAGACCCCCTTGTCCATAATC No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data
1014787464_1014787472 -7 Left 1014787464 6:125634928-125634950 CCCAGACCCCCTTGTCCATAATC No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014787464 Original CRISPR GATTATGGACAAGGGGGTCT GGG (reversed) Intergenic
No off target data available for this crispr