ID: 1014787471

View in Genome Browser
Species Human (GRCh38)
Location 6:125634943-125634965
Sequence CCATAATCTTTCAAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014787463_1014787471 5 Left 1014787463 6:125634915-125634937 CCATGGTCACTTTCCCAGACCCC No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data
1014787461_1014787471 23 Left 1014787461 6:125634897-125634919 CCATTCTCATAGGTCTATCCATG No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data
1014787464_1014787471 -8 Left 1014787464 6:125634928-125634950 CCCAGACCCCCTTGTCCATAATC No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data
1014787460_1014787471 24 Left 1014787460 6:125634896-125634918 CCCATTCTCATAGGTCTATCCAT No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data
1014787465_1014787471 -9 Left 1014787465 6:125634929-125634951 CCAGACCCCCTTGTCCATAATCT No data
Right 1014787471 6:125634943-125634965 CCATAATCTTTCAAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014787471 Original CRISPR CCATAATCTTTCAAACTGCT TGG Intergenic
No off target data available for this crispr