ID: 1014787472

View in Genome Browser
Species Human (GRCh38)
Location 6:125634944-125634966
Sequence CATAATCTTTCAAACTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014787463_1014787472 6 Left 1014787463 6:125634915-125634937 CCATGGTCACTTTCCCAGACCCC No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data
1014787464_1014787472 -7 Left 1014787464 6:125634928-125634950 CCCAGACCCCCTTGTCCATAATC No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data
1014787460_1014787472 25 Left 1014787460 6:125634896-125634918 CCCATTCTCATAGGTCTATCCAT No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data
1014787461_1014787472 24 Left 1014787461 6:125634897-125634919 CCATTCTCATAGGTCTATCCATG No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data
1014787465_1014787472 -8 Left 1014787465 6:125634929-125634951 CCAGACCCCCTTGTCCATAATCT No data
Right 1014787472 6:125634944-125634966 CATAATCTTTCAAACTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014787472 Original CRISPR CATAATCTTTCAAACTGCTT GGG Intergenic
No off target data available for this crispr