ID: 1014794606

View in Genome Browser
Species Human (GRCh38)
Location 6:125710324-125710346
Sequence AGGGAGAACGCAGGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014794597_1014794606 26 Left 1014794597 6:125710275-125710297 CCCTCAGCAGCAGTTGCATGTTG No data
Right 1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG No data
1014794598_1014794606 25 Left 1014794598 6:125710276-125710298 CCTCAGCAGCAGTTGCATGTTGC No data
Right 1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG No data
1014794596_1014794606 30 Left 1014794596 6:125710271-125710293 CCAACCCTCAGCAGCAGTTGCAT No data
Right 1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014794606 Original CRISPR AGGGAGAACGCAGGAATTGT GGG Intergenic
No off target data available for this crispr