ID: 1014796427

View in Genome Browser
Species Human (GRCh38)
Location 6:125730269-125730291
Sequence CACTTAGTATGTAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014796427_1014796434 22 Left 1014796427 6:125730269-125730291 CCAACTTCCCTACATACTAAGTG No data
Right 1014796434 6:125730314-125730336 TTGATGATATGACTAAGGAGTGG No data
1014796427_1014796433 17 Left 1014796427 6:125730269-125730291 CCAACTTCCCTACATACTAAGTG No data
Right 1014796433 6:125730309-125730331 ACTTTTTGATGATATGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014796427 Original CRISPR CACTTAGTATGTAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr