ID: 1014796427 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:125730269-125730291 |
| Sequence | CACTTAGTATGTAGGGAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014796427_1014796434 | 22 | Left | 1014796427 | 6:125730269-125730291 | CCAACTTCCCTACATACTAAGTG | No data | ||
| Right | 1014796434 | 6:125730314-125730336 | TTGATGATATGACTAAGGAGTGG | No data | ||||
| 1014796427_1014796433 | 17 | Left | 1014796427 | 6:125730269-125730291 | CCAACTTCCCTACATACTAAGTG | No data | ||
| Right | 1014796433 | 6:125730309-125730331 | ACTTTTTGATGATATGACTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014796427 | Original CRISPR | CACTTAGTATGTAGGGAAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||