ID: 1014798123

View in Genome Browser
Species Human (GRCh38)
Location 6:125748847-125748869
Sequence CCGCGGAGAAGCCCGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014798123_1014798131 1 Left 1014798123 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1014798131 6:125748871-125748893 GTCTAGGATCCACAGTCCCTGGG No data
1014798123_1014798130 0 Left 1014798123 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1014798130 6:125748870-125748892 GGTCTAGGATCCACAGTCCCTGG No data
1014798123_1014798137 18 Left 1014798123 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1014798137 6:125748888-125748910 CCTGGGGGCTGAAGACCCAATGG 0: 1
1: 0
2: 1
3: 26
4: 244
1014798123_1014798133 3 Left 1014798123 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1014798133 6:125748873-125748895 CTAGGATCCACAGTCCCTGGGGG No data
1014798123_1014798132 2 Left 1014798123 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1014798132 6:125748872-125748894 TCTAGGATCCACAGTCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014798123 Original CRISPR CCGCGGAGAAGCCCGTGGAC TGG (reversed) Intronic
903767377 1:25743483-25743505 CCGCTGAGTAGCCTCTGGACTGG + Intronic
904830985 1:33306728-33306750 CGGCGGAGAAGCCGGAGGGCCGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
920337024 1:205251696-205251718 CCCCTGAGAAGTCAGTGGACAGG - Intronic
922757053 1:228102501-228102523 CCGAGGAGAAGGGCGTGGACCGG - Exonic
924313738 1:242774446-242774468 CCGCGCTGGAGCCCATGGACTGG + Intergenic
1083048187 11:59755184-59755206 CCGGGGAGAGGCCCCTGCACCGG - Exonic
1084473925 11:69378177-69378199 CCAGGGAGAAGCCCATGGGCAGG - Intergenic
1087917860 11:103831311-103831333 CCTAGGAGAGGCCAGTGGACAGG - Intergenic
1089496115 11:118909495-118909517 CCCCGGAGAAGCCGGCAGACAGG - Intronic
1089560466 11:119340765-119340787 CCGGGGAGAAGCGCGGGGGCTGG - Exonic
1089880310 11:121766923-121766945 CCGCCGAGAAGCCAGAGGAGGGG - Intergenic
1100211846 12:92406595-92406617 CCGCAGAGGAGCCCATGGAGGGG + Intergenic
1103320844 12:120092207-120092229 CCATAGAGAAGCCTGTGGACAGG - Intronic
1121906425 14:97750400-97750422 CAGTGGAGAAGCCCGGGGACAGG + Exonic
1123062733 14:105601620-105601642 CCGGGAAGTAGCCCGTGGCCAGG + Intergenic
1202857031 14_GL000225v1_random:58129-58151 CCCCGCGGAAGCCCGGGGACTGG + Intergenic
1202860824 14_GL000225v1_random:80006-80028 CCCCGCAGAAGCCCGGGGACGGG - Intergenic
1202868358 14_GL000225v1_random:137018-137040 CCCCGCGGAAGCCCGGGGACGGG - Intergenic
1129892708 15:79082129-79082151 CTGCAGAGAGGCCAGTGGACTGG + Intronic
1132497035 16:268791-268813 CAGCGGAGAGGCTCTTGGACGGG + Exonic
1132565511 16:620725-620747 CCGCGGTGGAGCCCGTCGGCGGG - Intronic
1132565525 16:620760-620782 CCGCGGTGGAGCCCGTCGGCGGG - Intronic
1132565539 16:620795-620817 CCGCGGTGGAGCCCGTCGGCGGG - Intronic
1132983864 16:2753263-2753285 CCGAAGAGAAGCCCGAGGAAAGG - Intronic
1133219876 16:4315560-4315582 CCTCGGGGAAGCCCGAGGAGGGG - Intronic
1138683959 16:58708326-58708348 CCGGGGAGAATCCCCTGTACCGG - Intronic
1141558874 16:84853764-84853786 CCGTGGGGAAGCCCTTGGACCGG - Intronic
1148866337 17:50630703-50630725 CAGCTGAGCAGCCCGTGGAGTGG + Intergenic
1150130711 17:62667220-62667242 GCGCGGAGGACCCCGTGGTCTGG + Intronic
1150840237 17:68600524-68600546 CCGCGGGGGTGCCCGTGCACCGG - Exonic
1151662392 17:75525725-75525747 CCGCCCAGCAGCCCGTGGGCAGG + Exonic
1151857970 17:76736705-76736727 CCGCGGCGAAGCACGTGGTGCGG - Exonic
1152307732 17:79531050-79531072 GCGGGGAGGAGCCCCTGGACTGG - Intergenic
1157604979 18:48920736-48920758 CTGCTCAGAAGCCTGTGGACAGG + Exonic
1159616876 18:70591365-70591387 CTGGGGAGAAGCCGGAGGACTGG + Intergenic
1166533200 19:43554679-43554701 CCGCCGAGAAGCGCTGGGACCGG - Exonic
929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG + Intergenic
934679897 2:96276073-96276095 CAGCGGGGCAGCCCGTAGACAGG - Intronic
937996981 2:127701620-127701642 AGGCGGAGGAGCCCGGGGACCGG + Exonic
943830352 2:192452859-192452881 CCCCGGAGAAGCCAGGAGACAGG - Intergenic
947435173 2:230067203-230067225 CCGCGGAGAAGGCTGGGGAGCGG + Intronic
1171266540 20:23776161-23776183 CCTCTGAGAAGCCCATGGCCCGG - Intergenic
1175930681 20:62492447-62492469 CCGCCCATAAGCCCGGGGACAGG - Intergenic
1176173485 20:63707142-63707164 CCGTGGAGAAGCCCGGGGGAGGG - Intronic
1178924878 21:36766633-36766655 CCGTGGAGCAGCCCCTGTACAGG + Intronic
1180674934 22:17580707-17580729 CTGCGGAGGAGCCAGAGGACGGG + Intronic
1181478208 22:23181286-23181308 CCGCCGAGGAGCCCGAGGCCCGG + Exonic
1182260923 22:29072923-29072945 CCGCGGAGAGGCCCGGGGGGCGG - Intergenic
1185288957 22:50014620-50014642 CCGCCCAGGAGCCCGTGGCCTGG - Intergenic
949105845 3:198295-198317 CCGCGGAGCAGCCCCAGGGCCGG + Intronic
965044096 3:163552398-163552420 CCGCACAGAAGCCCATGGAGTGG + Intergenic
968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG + Intergenic
974590558 4:63942958-63942980 CCGCACAGGAGCCCGTGGAGGGG + Intergenic
976409015 4:84691524-84691546 CAGCTGACAAGCCCTTGGACTGG + Intronic
995402539 5:111758153-111758175 CCGCGGGGAAGCCCGGGGCGGGG + Intronic
997374274 5:133385596-133385618 CCTCAGAGGAGCCAGTGGACAGG - Intronic
1003100231 6:3171049-3171071 CCGCGCAGGAGCCCATGGAGAGG - Intergenic
1004511685 6:16288540-16288562 CCGCACAGGAGCCCGTGGAGGGG - Intronic
1006008345 6:31021005-31021027 CCGCACAGAAGCCCATGGAGGGG - Intronic
1006301634 6:33196518-33196540 CCGAGGAGATGCCTGTGGACAGG - Exonic
1007383052 6:41503001-41503023 CCGCGGAGAAGGCGGTGAGCTGG + Intergenic
1007748470 6:44057399-44057421 CTGGGGAGAAGTCTGTGGACTGG - Intergenic
1014798123 6:125748847-125748869 CCGCGGAGAAGCCCGTGGACTGG - Intronic
1022108623 7:27214125-27214147 CCGCAGAGAAGCCCTCGGGCAGG - Intergenic
1026947864 7:74327825-74327847 CCATGGAGAAGCCCGTGGCCAGG - Intronic
1031986560 7:128167739-128167761 CCCCGGCTAAGCCCGGGGACGGG + Intergenic
1036227542 8:6972174-6972196 CTGCGGAAATGCCTGTGGACTGG - Intergenic
1040866781 8:52055514-52055536 CAGTGGAGAAGCCCCAGGACAGG - Intergenic
1041384098 8:57280218-57280240 CTGCTGAGACGCCTGTGGACTGG - Intergenic
1049778264 8:144416150-144416172 CCTCGGGGAAGCCCCTGGCCAGG - Intronic
1049779557 8:144422586-144422608 CCGCCAAGAAGCCGGAGGACTGG - Intergenic
1050294952 9:4195576-4195598 CCGCGTGGGAGCCCGTGGAGGGG - Intronic
1052362168 9:27573229-27573251 CCGCCGGGAAGCCCGGGGCCCGG + Intronic
1053239916 9:36487352-36487374 GCCCGGAGAGGCCCGTGGCCCGG + Intronic
1061408567 9:130405983-130406005 CCGCTGAGAACGCCGTGGGCCGG + Intronic
1062129689 9:134885745-134885767 CTGTGGAGAAGCCAGGGGACAGG - Intronic
1062315354 9:135964483-135964505 CCGCTGTAAAGCCCGTGGCCAGG - Intergenic
1203736420 Un_GL000216v2:143250-143272 CCCCGCGGAAGCCCGGGGACGGG + Intergenic
1199847549 X:151701971-151701993 TTGTGGAGAAGCCCGTGGCCTGG + Exonic
1201175599 Y:11306950-11306972 CCCTGCAGAAGCCCGGGGACGGG + Intergenic
1201176862 Y:11314953-11314975 CCCCGCGGAAGCCCGGGGACTGG + Intergenic
1201177990 Y:11321590-11321612 CCCCGCGGAAGCCCGGGGACGGG + Intergenic