ID: 1014798283

View in Genome Browser
Species Human (GRCh38)
Location 6:125749533-125749555
Sequence CCGCCCCCGCGCACCGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 7, 3: 70, 4: 535}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014798283_1014798294 7 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798294 6:125749563-125749585 GGCCCCACCCGCTCGAGGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 109
1014798283_1014798302 17 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798302 6:125749573-125749595 GCTCGAGGGGGGGGCGTGGCCGG 0: 1
1: 0
2: 0
3: 31
4: 364
1014798283_1014798291 4 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798291 6:125749560-125749582 GGTGGCCCCACCCGCTCGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 122
1014798283_1014798292 5 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798292 6:125749561-125749583 GTGGCCCCACCCGCTCGAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 49
1014798283_1014798295 8 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798295 6:125749564-125749586 GCCCCACCCGCTCGAGGGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 143
1014798283_1014798289 2 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798289 6:125749558-125749580 GAGGTGGCCCCACCCGCTCGAGG 0: 1
1: 0
2: 0
3: 10
4: 76
1014798283_1014798303 23 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798303 6:125749579-125749601 GGGGGGGGCGTGGCCGGCGCCGG 0: 1
1: 0
2: 8
3: 131
4: 1339
1014798283_1014798293 6 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798293 6:125749562-125749584 TGGCCCCACCCGCTCGAGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 89
1014798283_1014798290 3 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798290 6:125749559-125749581 AGGTGGCCCCACCCGCTCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 41
1014798283_1014798299 13 Left 1014798283 6:125749533-125749555 CCTGGGCCGGTGCGCGGGGGCGG 0: 1
1: 0
2: 7
3: 70
4: 535
Right 1014798299 6:125749569-125749591 ACCCGCTCGAGGGGGGGGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014798283 Original CRISPR CCGCCCCCGCGCACCGGCCC AGG (reversed) Intronic
900418658 1:2546274-2546296 CCGCCCCCTAGCTCCGGGCCGGG - Intergenic
900550030 1:3250064-3250086 CCGCCCCTGGGGACCAGCCCAGG + Intronic
900644426 1:3702568-3702590 CAGCCCCCACGCACCCACCCAGG - Intronic
901109770 1:6785436-6785458 CCGCCGCCGCGCACCCGCCCTGG - Exonic
901198557 1:7453872-7453894 CCGGCCCCCCGCAGCAGCCCGGG + Intronic
901332809 1:8423868-8423890 GGGGCCCCGCGCCCCGGCCCCGG + Intronic
901631249 1:10649232-10649254 TCGTCCCCCCGCACCCGCCCTGG - Intronic
901660838 1:10796760-10796782 CCGGCCCCGCGATCCGGCCCGGG - Intergenic
902304119 1:15524295-15524317 CTGCCCCCGCGTCACGGCCCCGG + Exonic
902842861 1:19086329-19086351 CCACCCCCGCCCCCCCGCCCAGG - Intronic
903266286 1:22159981-22160003 CCGCCCTGGCGCAAGGGCCCTGG - Intergenic
903283730 1:22264512-22264534 CTGACCCCGAGCACAGGCCCAGG - Intergenic
903413712 1:23167879-23167901 CGGCCCCCGCCCAGCCGCCCGGG - Intronic
903650556 1:24919199-24919221 CCTCCCCCGCGCAGGGGCTCAGG + Intronic
904528813 1:31155037-31155059 CCGCCCTCGTCCCCCGGCCCGGG - Intergenic
904837759 1:33349934-33349956 CCGCTCCCTCGCCCCGCCCCCGG - Intronic
905151455 1:35931098-35931120 CCGCCGCCGCCGACCTGCCCGGG - Exonic
905442696 1:38005295-38005317 CCGCCCCCGCGCCCAGGCCGGGG - Intronic
905548459 1:38818020-38818042 CCGGCCGCGCGCACAGGGCCCGG - Intergenic
905626186 1:39491817-39491839 CCCCCCGCGCGCACCTGCCCCGG - Exonic
905960012 1:42035677-42035699 CCGCCCCCCGGGACCGCCCCCGG + Intronic
906120914 1:43389942-43389964 CAGCCCTCCCGCGCCGGCCCGGG - Intronic
907051076 1:51330335-51330357 CTCCCCCCGCGCACCGGCCTGGG - Intronic
907261331 1:53220675-53220697 CCTGCCCCGCGGCCCGGCCCCGG - Intergenic
907364171 1:53945977-53945999 CCGCCCCCTCGCGGCGGCCTCGG + Intergenic
907444741 1:54500227-54500249 CCGCCCCCGCTCCCCGAGCCAGG - Intergenic
908128290 1:61050956-61050978 CTGCCCCCACCCACCGGCGCGGG - Intronic
912246384 1:107965276-107965298 CCTCCCCCGCGCCCCGCCCTCGG - Intergenic
912305230 1:108560229-108560251 CTGCCGCCGCGTTCCGGCCCAGG + Exonic
912927950 1:113929823-113929845 CCCCCCGCGCGAGCCGGCCCGGG - Exonic
913209360 1:116570496-116570518 CCGCGCCCGCTCCCCGTCCCGGG + Intronic
913274172 1:117121709-117121731 CCTCTCCCGCGCCTCGGCCCGGG + Exonic
913544393 1:119853256-119853278 CCTCCCCCGCCCGCCAGCCCAGG + Intergenic
914588458 1:149084530-149084552 CCTCCCCCACCCACCAGCCCAGG + Intronic
915588737 1:156859116-156859138 CGGCCCCTGCGTGCCGGCCCTGG - Intronic
915747773 1:158177932-158177954 CTGGCCCCGCGCCCCGCCCCAGG + Intergenic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
917944460 1:179954857-179954879 CTGGCCCCGCTCCCCGGCCCGGG - Exonic
917974265 1:180229443-180229465 CCACCTCCGCGCACAGCCCCTGG + Intergenic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
922124911 1:222712522-222712544 CCGCCCCCGAGGCCCCGCCCCGG + Exonic
922526705 1:226309413-226309435 CTCCCCCCGCGCTCCGGCGCCGG - Exonic
922739362 1:228006867-228006889 CCCCGCCCGGGCCCCGGCCCCGG + Intergenic
922739389 1:228006919-228006941 CCGCCGCCCCGCGCCGCCCCGGG + Intergenic
922815516 1:228446327-228446349 CCGCAACGGCGCACAGGCCCAGG - Intergenic
923496581 1:234530984-234531006 CCCACCCCCCGCACCGCCCCAGG + Intergenic
923506416 1:234609668-234609690 CGGCGCCCGCGCAGCGCCCCCGG + Intergenic
923684142 1:236142402-236142424 CGGCCCGCGCGCCCCCGCCCCGG - Intergenic
923986355 1:239386897-239386919 CCGCCTCCGGGCAGCGGCCGCGG - Intronic
924482603 1:244451182-244451204 CCGCCCCCCCGCCCCGCCCAGGG - Intronic
1063663532 10:8049213-8049235 ACGCCCACGCGCCCCGGGCCAGG - Intergenic
1063929795 10:11017870-11017892 CCGCCCCCGCCCGCCGCACCTGG + Intronic
1064747321 10:18490837-18490859 CCCCCCTCCCCCACCGGCCCGGG - Intronic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1066427263 10:35319003-35319025 CCGCCACTGCACTCCGGCCCAGG - Intronic
1067370630 10:45678661-45678683 GCGGCCCCGGGCACCAGCCCTGG - Intergenic
1067389145 10:45847482-45847504 GCGGCCCCGGGCACCAGCCCTGG + Intronic
1067502329 10:46816359-46816381 GCGGCCCCGGGCACCAGCCCTGG - Intergenic
1067592258 10:47523661-47523683 GCGGCCCCGGGCACCAGCCCTGG + Intronic
1067639375 10:48031734-48031756 GCGGCCCCGGGCACCAGCCCTGG + Intergenic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1069615063 10:69801725-69801747 CGGCCCCAGCCCGCCGGCCCGGG - Intergenic
1072706922 10:97687441-97687463 CCGCCCCCGCGCGGCGCCCGAGG + Intergenic
1073063608 10:100745978-100746000 CCGGCCCGGCCCACCGCCCCGGG + Exonic
1073088536 10:100912714-100912736 CCGCCCCCGCGCGCCGGCCAAGG + Intronic
1073099583 10:100999749-100999771 CCGCCCACTCGCACCGGGCGGGG + Exonic
1073265632 10:102226687-102226709 ACCCCCTCGCGCCCCGGCCCCGG - Intronic
1073336724 10:102715073-102715095 GCGCCACCGCACTCCGGCCCGGG - Intronic
1074801439 10:117004967-117004989 CCGTCCCCGCCCACGGGCCGCGG + Intronic
1075748430 10:124743981-124744003 CCGCCGCCGCCGCCCGGCCCCGG + Intronic
1076035579 10:127196424-127196446 CCGCCCCCGCCTCCTGGCCCTGG - Intronic
1076469482 10:130708550-130708572 CCGCCCGCGTGCACTGGGCCTGG + Intergenic
1076638744 10:131900454-131900476 GCGCCCCCGCACTCCAGCCCGGG + Intergenic
1076792456 10:132784652-132784674 CCGCCTCCTCGCGCCTGCCCGGG + Intergenic
1076792761 10:132785738-132785760 CCGCGCCCACGGGCCGGCCCAGG + Exonic
1076792832 10:132785996-132786018 CCGCCCCTGCCCGCCGGCCCGGG + Exonic
1076909286 10:133379231-133379253 CCGCCCCCTCGCTCCGCCTCCGG + Exonic
1076981803 11:208751-208773 CCTCCCCCGCGCGCTGGCGCGGG + Exonic
1077081365 11:726034-726056 CCGCCTCCCAGCACCTGCCCGGG - Intronic
1077085316 11:747230-747252 CAGCCGCCGCGGACGGGCCCGGG - Intergenic
1077201485 11:1309626-1309648 CAGCCGCCGCGCCCCGCCCCCGG + Intronic
1077250445 11:1558454-1558476 CCCACCCCCCGCACGGGCCCAGG - Intronic
1077416425 11:2426300-2426322 CCGCCCCCGCCGGCCAGCCCAGG + Intergenic
1077581914 11:3422567-3422589 CTGCCCCCGCGCACTGCCCTGGG - Intergenic
1078091731 11:8268389-8268411 GTGCCCCCGGGCACCGGCACCGG + Intronic
1078316058 11:10294117-10294139 CCGCCGCCGCCCACCCGGCCCGG + Exonic
1078771768 11:14358633-14358655 CCGCCCCCTGGCCCCGGCCCGGG + Intronic
1079296833 11:19241683-19241705 ACGCCCGCTCGCCCCGGCCCCGG + Intergenic
1080418650 11:32091646-32091668 CCGCCGCCGCGCCCCGGCCGGGG + Intronic
1080551285 11:33375993-33376015 CCGCTCCCGCGCGCCCGGCCGGG - Intergenic
1081462317 11:43283266-43283288 CCACTCCCCCGCACCGCCCCCGG - Intergenic
1081636892 11:44727350-44727372 ACCCCCCCGCGCGCCGCCCCGGG + Intronic
1081774076 11:45665768-45665790 CCGCCCCCACCCACCCGCCGGGG + Intergenic
1081831604 11:46120387-46120409 CCGCCCCCGCCCGCAGCCCCCGG + Intronic
1082076493 11:47980046-47980068 CAGCCCCCGAGCGCCGGCCAGGG - Intergenic
1083317899 11:61827806-61827828 CCTCCCCCACTCTCCGGCCCCGG - Exonic
1083886505 11:65575979-65576001 CCGCCCCCGCGCTCCTGCCCCGG + Intergenic
1084146151 11:67266426-67266448 CCGCCCGCGCGCCCGCGCCCCGG - Exonic
1085325536 11:75603581-75603603 CCGCCCCCACTCACTGCCCCAGG - Intronic
1085561049 11:77473485-77473507 CCACCCCCGCGCCCCAGCCCTGG + Intronic
1088613613 11:111602362-111602384 CCGCCCCCGCCCCCCTGCCCCGG + Intergenic
1089273211 11:117315692-117315714 CTGCCCCTGCGCAGCGGCCTGGG - Exonic
1089442908 11:118531245-118531267 CCGCCCCCGCCCCCCGCCACCGG - Intronic
1089499822 11:118925510-118925532 CCGGCCCCGCGCCCCGGCCCCGG - Intronic
1090285383 11:125495456-125495478 CCGCCACCGCGCAGCCGCCCCGG + Exonic
1090361371 11:126175155-126175177 CCGCCCCCCGCCACCTGCCCAGG + Intergenic
1090399553 11:126440417-126440439 CGGCCCCCGCCCGCCGTCCCTGG + Intronic
1090425398 11:126603725-126603747 CAGCCCCAGCACACCTGCCCAGG - Intronic
1090473977 11:127003538-127003560 CTTCCCCCGCGCGCCGCCCCCGG - Intergenic
1090780296 11:130001955-130001977 CCGGCCCCCCGCCCCGGTCCCGG + Intronic
1091286588 11:134411855-134411877 CGGCCCCTACGCCCCGGCCCCGG + Intronic
1091550200 12:1530726-1530748 CCAGCCCCGCGCCCCGGCCGCGG + Intronic
1091807370 12:3366045-3366067 CCGCCCGCGCTCACCTGGCCCGG + Intergenic
1092250257 12:6891146-6891168 CCCGCCCCGCGCAGCCGCCCAGG + Intronic
1092861831 12:12725259-12725281 CCTGCCCCGCGCTCCGGCCGCGG + Intergenic
1093898103 12:24598980-24599002 CCACCCCCGCCGACAGGCCCCGG + Intergenic
1094624056 12:32106587-32106609 CCGCCCCCGCGAGCCGGACAGGG + Intergenic
1096482503 12:51951841-51951863 CGGCCCCCGCCCCCCGTCCCAGG - Intronic
1096796738 12:54082567-54082589 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1097155022 12:57006268-57006290 CCCCGCCCGCGCGCCGACCCCGG - Intronic
1100869500 12:98895170-98895192 CAGCCCCCGCGCGCCGCGCCTGG - Intronic
1100963065 12:99984720-99984742 CCGCCCCCGCGTAACCGCCGAGG - Intergenic
1101466839 12:104958087-104958109 CCGCCGCCGCGCTCCGGAACAGG - Intronic
1101479575 12:105084311-105084333 CCGCCCCGGCCCTCCCGCCCCGG + Intronic
1102197148 12:111033959-111033981 CCGCCGCCGCCAACGGGCCCGGG - Intergenic
1103092003 12:118104070-118104092 CAGCCTCCGCGCCCCGCCCCTGG - Intronic
1103749845 12:123151089-123151111 CTGCCCGCGCGCGCCGGGCCGGG + Intergenic
1103856325 12:123973102-123973124 CCGCCCCCGCCCCCCAGCCCCGG - Exonic
1105031410 12:132887159-132887181 CCGGCCCCGGCCCCCGGCCCCGG + Intronic
1105418284 13:20231934-20231956 CTGTCCACGCGCCCCGGCCCCGG - Intronic
1105535181 13:21259334-21259356 CCCCCCCCGCACCCCGTCCCCGG - Intergenic
1105964416 13:25371961-25371983 CCGCCCCCACGCCGCAGCCCGGG + Intergenic
1106457006 13:29936257-29936279 CCATCCCCCCGCACCTGCCCAGG - Intergenic
1107058399 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1110318277 13:74134549-74134571 CTGCCCCCGCCCTCCGGCCCCGG + Intergenic
1110412495 13:75219881-75219903 CCGCCCCCGCTCAGCCGTCCAGG - Intergenic
1112272015 13:97976862-97976884 CGGCCGCCGCGGACCGGCCGAGG - Intronic
1112325201 13:98439220-98439242 CTGCCCCCGAGGACAGGCCCTGG - Intronic
1112344303 13:98577173-98577195 CCGCCCCCACGGCCCGGCCGGGG + Intronic
1112506991 13:99981403-99981425 CCGCCCCGGCGCCCCCGCCGCGG + Intergenic
1113378887 13:109786004-109786026 CCGTCTCCGCTCGCCGGCCCGGG + Exonic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1113541819 13:111115281-111115303 CCGCCGCCGCCCCCCGGCCTCGG - Exonic
1113748903 13:112765149-112765171 CCTCCCCCCCGCCCCGGCTCTGG + Intronic
1113834755 13:113321497-113321519 CCGCCCCCGCCCGCGCGCCCAGG + Intronic
1115502270 14:34060366-34060388 CAGCCCGCACGTACCGGCCCCGG + Intronic
1117119706 14:52553619-52553641 GCGGCCCCGCGCACCCGCCCGGG - Intronic
1117141020 14:52791394-52791416 CTGCTCTCGCGCCCCGGCCCCGG + Intronic
1117478345 14:56118874-56118896 CCGCCCCCGCGCCGCCGTCCGGG - Intronic
1119435553 14:74595596-74595618 CCAGCCCCGCGCCCAGGCCCAGG + Intronic
1120788028 14:88554739-88554761 CCGCACCCGCACGCCAGCCCGGG + Intergenic
1122221198 14:100239931-100239953 CCGGCCGCGCGCCCCGGCCCCGG + Intronic
1122775038 14:104113335-104113357 CCCCACCCGCCCACCTGCCCAGG - Exonic
1122888993 14:104724082-104724104 CCGCCCCCTCGCCGCTGCCCGGG - Intergenic
1122916935 14:104863806-104863828 CCCCCCCCGCCCTCCAGCCCAGG + Intergenic
1123021050 14:105398217-105398239 CCGCCCGCGCGCCCCGTCCTGGG + Intergenic
1123500814 15:20878826-20878848 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123558065 15:21452521-21452543 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123594293 15:21889802-21889824 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1124109456 15:26772964-26772986 CCTCCGCCGCGCCCCGGCACGGG + Exonic
1124118459 15:26868078-26868100 CTGCCCTGGCGCGCCGGCCCTGG + Intronic
1124629563 15:31328591-31328613 CGCCCGCCCCGCACCGGCCCAGG - Intronic
1125641080 15:41231227-41231249 CCTCCCCAGCGCACCACCCCTGG + Exonic
1127433292 15:58933204-58933226 CCCGCCCCGCGCCCCGGGCCGGG - Intronic
1127753419 15:62067984-62068006 GCCCGCCCGCGCCCCGGCCCCGG + Exonic
1127763641 15:62164607-62164629 GCCCGCCCGCGCCCCGGCCCCGG - Exonic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1128743591 15:70098997-70099019 CCGCTCGCTCGCCCCGGCCCCGG + Intergenic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1128992504 15:72272547-72272569 CCGCCCCCGCGGGGCGTCCCGGG - Exonic
1129082389 15:73052410-73052432 CCGCCCCCCCCCCCCCGCCCCGG + Intronic
1129612315 15:77070785-77070807 CGGCCCCCGCGCGCCCGCCCAGG + Intronic
1129675935 15:77632511-77632533 CCACTCCCGAGCCCCGGCCCCGG - Intronic
1131085894 15:89575551-89575573 CCGCCCCGGGGCCCCGGTCCGGG - Exonic
1202966415 15_KI270727v1_random:179693-179715 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1132478424 16:153870-153892 CGGCCCCCGCCCCCCGTCCCAGG + Exonic
1132480509 16:164460-164482 CGGCCCCCGCCCCCCGTCCCAGG + Intronic
1132641987 16:982175-982197 CCGCCGCCGCGCACCGGCATGGG - Exonic
1132658617 16:1051750-1051772 CCGCCCCCACGCCCAGACCCCGG - Intergenic
1132719504 16:1308975-1308997 TCCCGCCCGCGCCCCGGCCCAGG + Exonic
1132779403 16:1614435-1614457 CCGGCCCTGCCCACCAGCCCGGG - Intronic
1132854450 16:2038625-2038647 CTGCCCCTGCCCACCTGCCCTGG + Exonic
1132855323 16:2042369-2042391 CTGCCCCGGCGCACCTGGCCTGG + Intronic
1132897745 16:2236967-2236989 ACGCCGCCCCGCCCCGGCCCGGG - Intronic
1132998461 16:2836626-2836648 CCGCACCCACCCCCCGGCCCAGG + Intronic
1133032985 16:3020519-3020541 CGGCTCCCGAGCCCCGGCCCGGG - Intronic
1133097487 16:3457699-3457721 TGGCCCCCCCGCACAGGCCCTGG - Intronic
1133201804 16:4208386-4208408 CCGCCCCCGCACCGCGACCCTGG + Intronic
1133218547 16:4307944-4307966 CCGCCCCCTCGTTCCTGCCCTGG + Intergenic
1133286148 16:4691833-4691855 CAGCCCCCGCTCCCCTGCCCAGG + Intergenic
1133588072 16:7215062-7215084 CACCCCCCGCGGACAGGCCCTGG + Intronic
1133771479 16:8869104-8869126 CCGCCCGCCCCCACCGTCCCGGG - Intergenic
1134121403 16:11587026-11587048 CCGCCCCCGCGGCCCGCACCTGG + Intronic
1134149775 16:11796922-11796944 CCCTCCGCGCGCACAGGCCCCGG + Intronic
1135016076 16:18926115-18926137 CCGACACCCCGCTCCGGCCCGGG + Exonic
1135047629 16:19168232-19168254 CCTCCTGCGCGCTCCGGCCCCGG + Exonic
1135335803 16:21599912-21599934 CCACGCCCCCGCCCCGGCCCCGG - Intronic
1136333166 16:29595040-29595062 CCGACACCCCGCTCCGGCCCGGG + Intergenic
1136447860 16:30335106-30335128 CCGACACCCCGCTCCGGCCCGGG + Intergenic
1136505199 16:30698596-30698618 ACAGCCTCGCGCACCGGCCCCGG - Intronic
1136636866 16:31529621-31529643 CCGCCCCCGCTCAGCACCCCGGG - Intergenic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137300254 16:47142989-47143011 CGGCGCCCGCGCGCCGCCCCCGG + Intronic
1137454852 16:48610210-48610232 CCGCCGCCGCGCATGCGCCCCGG + Intronic
1137665283 16:50246058-50246080 CCGCCCCCGCGCCCCAGGCCTGG + Intergenic
1137787598 16:51151362-51151384 CCTCCCCGGCTCCCCGGCCCCGG + Intronic
1138381898 16:56608435-56608457 CCGGCCGCGCGCACTGGGCCGGG - Exonic
1138619137 16:58197880-58197902 CCGCCCCCGCGGGCCCGGCCTGG - Exonic
1139597889 16:67968689-67968711 CCGCCCCCGAGGGGCGGCCCGGG - Exonic
1142037191 16:87869547-87869569 CCGGCCCCGCCCACCGTCCGCGG + Intergenic
1142081770 16:88153095-88153117 CCGGCCCCGCCAACCTGCCCGGG - Intergenic
1142367556 16:89657984-89658006 CCGCCCCTGGGCGCGGGCCCAGG + Intronic
1142376915 16:89711280-89711302 GAGCCCCTGCGCACCGGCCTTGG - Intronic
1142501641 17:336462-336484 CCGCCCCCGGGCACCCTGCCAGG + Intronic
1142695014 17:1628743-1628765 CTGCCCCCGCGCCCTCGCCCCGG + Intronic
1142855105 17:2724703-2724725 CAGGCCCCGCGCCCGGGCCCCGG - Intergenic
1142865270 17:2786991-2787013 GCGCCCCTGCGCACCAGCCTGGG - Intronic
1143099814 17:4498911-4498933 CGGCTCCTGCGCTCCGGCCCCGG - Exonic
1143274030 17:5696639-5696661 CCGCCCCCATGCACCTGCCCAGG + Intergenic
1143409642 17:6701177-6701199 CCGTCCCCACGCACAGGGCCAGG - Intronic
1143598443 17:7929344-7929366 CCGCCCCCGGGGCCCGGCCGGGG + Exonic
1144586693 17:16491771-16491793 CCGCCTCCTCCCGCCGGCCCTGG + Exonic
1144586905 17:16492418-16492440 TCGCCCCCGCGCCACGGCCCCGG - Intergenic
1144851691 17:18247134-18247156 CCCCCCCCGCGCCCCGGTCCCGG + Intronic
1145260660 17:21352553-21352575 CCTCCCCCGACCACCGGCCTAGG - Intergenic
1146912569 17:36658055-36658077 ACTCCCGCCCGCACCGGCCCGGG - Intergenic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG + Intronic
1147200702 17:38799597-38799619 CCGCCCTCCCGCCCCGCCCCGGG + Exonic
1147970887 17:44218832-44218854 CCGCCCCCGGGGACCGGATCCGG + Intronic
1148048717 17:44759082-44759104 CCGGCCCCGCGCCCCCGCCCCGG + Exonic
1148122667 17:45222024-45222046 CTGCCCCCTCGCCCCCGCCCGGG + Exonic
1148696806 17:49565265-49565287 CCGCCACCGCACTCCAGCCCAGG + Intergenic
1149678586 17:58488093-58488115 CCGCCACCGCCCCCCGGCCCGGG + Exonic
1149994584 17:61399993-61400015 CCGCCCCCGCGCACAGAGCCGGG + Exonic
1150239942 17:63622915-63622937 CCGCTCGCGCGCCGCGGCCCGGG + Intronic
1151857912 17:76736520-76736542 CCGCCCGCGCGCTCCCGCCCAGG + Exonic
1152303626 17:79509113-79509135 CAGCCCCAGGGCCCCGGCCCTGG + Intronic
1152396303 17:80035759-80035781 CCGCCCCCGCGGCCCCGTCCGGG + Intronic
1152461771 17:80445554-80445576 CCGCCCCCGCGCTCCCGGCGGGG - Intergenic
1152622415 17:81372060-81372082 CCCCCCCCAAGCACCGACCCTGG - Intergenic
1152625660 17:81386944-81386966 TCGCCGCCGCGCCCCGCCCCCGG - Intergenic
1152708940 17:81860593-81860615 CCGCCCGCGCGCGCTGGCCGCGG + Exonic
1152729058 17:81961032-81961054 CCGCTCCCGCCCGCCGGGCCTGG + Exonic
1152812130 17:82387031-82387053 CCTCCCCGGAGCACCCGCCCTGG + Intergenic
1152834365 17:82519849-82519871 GCGCCCGCGCGGAGCGGCCCGGG + Exonic
1152864904 17:82716726-82716748 CCGCGGCCGCGGACCCGCCCCGG - Exonic
1153041000 18:812564-812586 CCGCCCCCGGGAATCCGCCCCGG - Intergenic
1154066353 18:11110698-11110720 CCGCCCCGGCCCGCCCGCCCCGG + Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1154954611 18:21242180-21242202 CCGCCGCCTCGCTCCGCCCCGGG + Intergenic
1155300718 18:24426700-24426722 CCGCCCCCGCGCTCCGGACCTGG + Exonic
1156099744 18:33578740-33578762 CCGCCGCCGCGGACCGGCGCGGG - Intronic
1156275710 18:35581453-35581475 CCTCCCCCGCGCAGCCGCACGGG + Intronic
1159586759 18:70289308-70289330 CGGCCCCCGTTCCCCGGCCCTGG - Intronic
1159586785 18:70289369-70289391 GGGCCGCCGCGCCCCGGCCCCGG - Intronic
1160157016 18:76441944-76441966 CCGCACGCGCGCCCCGGCCGAGG - Exonic
1160499309 18:79394452-79394474 CGACCCCCGCCCACCGGCCTGGG + Intergenic
1160631205 18:80247418-80247440 GCGCCCCCAGGCCCCGGCCCCGG + Exonic
1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG + Intronic
1160691055 19:460846-460868 CCGCCGCCGGGCCGCGGCCCAGG + Exonic
1160766693 19:811947-811969 CCGCCCCCGCGTCCTGTCCCGGG + Exonic
1160782687 19:884854-884876 CCGCCCCCGAGGGCAGGCCCAGG + Intronic
1160797591 19:953079-953101 CCTCCCCAGCCCACCGGCTCTGG - Intronic
1160831128 19:1105292-1105314 CCGACCCCGCGCCCCACCCCAGG - Intronic
1160863722 19:1248452-1248474 CCGCCCCTGCCTGCCGGCCCTGG - Intergenic
1160947873 19:1652013-1652035 CGCCCCCCGCGCCCCCGCCCGGG + Intronic
1160971010 19:1767766-1767788 CCGCCCCAGGGCACCGTCCTGGG - Intronic
1161222029 19:3122309-3122331 CCGCCCCCGAGCGCCGCCCCCGG + Exonic
1161252115 19:3285863-3285885 CCCTCCCCGCCCAGCGGCCCAGG + Intronic
1161306796 19:3573175-3573197 CCCCCCCAGCGCTCCGGGCCCGG + Intronic
1161560299 19:4969287-4969309 CCGCCCCCGCGTCGCGGCTCGGG + Intronic
1161596203 19:5152260-5152282 CCGCCCCTGTGCACCTGGCCAGG + Exonic
1161800730 19:6415644-6415666 CAGCCCCCGGGCCCCGTCCCCGG - Exonic
1161960323 19:7519667-7519689 CCGCCCCCGCCAGCCCGCCCCGG + Exonic
1162019764 19:7863081-7863103 CCGCCCCCGCCCCCCGACCCCGG - Intronic
1162079356 19:8209297-8209319 CCGCCCCCACGGCCCCGCCCCGG + Intronic
1162470919 19:10871651-10871673 CCGCCGCTGCGCCCGGGCCCAGG - Exonic
1162524140 19:11197639-11197661 CCGCCCGGGCGCCCCGGCCGCGG + Intronic
1162772407 19:12957106-12957128 CCGCCCCCGCGCCGCAGGCCGGG - Exonic
1162778711 19:12995806-12995828 CGGCCGCCGCGCTCCCGCCCGGG + Exonic
1162802269 19:13118183-13118205 CCCCGCCCGCGCACCGCCCTCGG - Intronic
1162959619 19:14118090-14118112 CCGCCCCGCCCCGCCGGCCCGGG - Intergenic
1163508019 19:17719681-17719703 CCGCCCCACCCCGCCGGCCCCGG - Intronic
1163591820 19:18198117-18198139 CCAGCCCCGTGCACTGGCCCTGG + Intronic
1163804059 19:19385592-19385614 CCGCCTCCTCGGACCCGCCCCGG + Intergenic
1163842302 19:19618825-19618847 CCGGCGCCACGCACCGCCCCCGG + Exonic
1164615776 19:29665947-29665969 CCCCCGCCGCGCCCCTGCCCAGG - Intronic
1165278196 19:34772903-34772925 CCGACCCCGGGCTCCGGCTCTGG + Exonic
1165349734 19:35269184-35269206 GTGCCCCCGCGCCCCGGCCCCGG + Intronic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1165349788 19:35269308-35269330 CCGCCCCCGGCCCCCGGCCTCGG + Intronic
1165404091 19:35619483-35619505 CCTCCCCCGGGCTCCGGCACAGG - Exonic
1165573663 19:36796237-36796259 CCGCCCCTGCGCTCCAGCCTGGG - Intergenic
1166075232 19:40410350-40410372 CCGCCCCTGCCCACCCACCCTGG + Intronic
1166731889 19:45064045-45064067 CCGCTCCCGCTCCCCGACCCCGG + Exonic
1166809353 19:45506638-45506660 CCGCCCCCACACGCCGGCTCCGG - Intronic
1167040040 19:47018761-47018783 CCGCCACTGCGCTCCAGCCCGGG - Intergenic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167622754 19:50568339-50568361 CCCCCCCCAGGCCCCGGCCCCGG + Intergenic
1167649031 19:50719588-50719610 CCCCCCCCGCGGGCCGGGCCTGG + Intergenic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168239534 19:55082198-55082220 TCGTGCCCGCGCCCCGGCCCAGG - Intronic
1168536023 19:57171917-57171939 CCGCTCGCGCCCCCCGGCCCGGG - Intergenic
924962321 2:46133-46155 CCCGGCCCGCGCCCCGGCCCCGG - Exonic
925034791 2:677004-677026 CCCTCCCCGCCCAACGGCCCAGG + Intronic
925068835 2:950792-950814 CCGCCCACGCAGACCCGCCCCGG - Intergenic
925610387 2:5696816-5696838 CCCTCCCCGCGCGCCGGCTCAGG + Exonic
926801845 2:16665930-16665952 CAGCCGCCCCGCCCCGGCCCCGG + Intronic
926914316 2:17878409-17878431 CCGGCCGCGCGCCCCCGCCCAGG - Intronic
927052962 2:19348297-19348319 CCCGCCCCGCGAATCGGCCCAGG - Intergenic
927652256 2:24919943-24919965 CCGGCCCAGCGCGCCCGCCCTGG + Intergenic
927713788 2:25340849-25340871 CGGCCCCCGCGGCCCGGGCCCGG + Intronic
927982096 2:27380628-27380650 CCGCCCCCATGCAGCGGCGCGGG + Exonic
931256896 2:60581849-60581871 CCGCCCCTGCGCGCCGAACCAGG - Intergenic
931348721 2:61470499-61470521 GCGCCACCGCGCACCTTCCCGGG + Intronic
932621778 2:73269098-73269120 CCGCCGCCTGGCCCCGGCCCCGG - Exonic
932812014 2:74833923-74833945 CCTCCCCCGCCCCCCGCCCCCGG + Intergenic
933666878 2:84971325-84971347 CCGCCCCCGCGGCCGAGCCCGGG + Exonic
934566940 2:95346475-95346497 CGGCCCCCCCGCGCCTGCCCGGG - Intronic
934735526 2:96687973-96687995 CCACCCCCGCGTGCCTGCCCTGG - Intergenic
935112284 2:100104723-100104745 CCGCCGCCGCCCCCCGCCCCCGG + Intronic
935592752 2:104856279-104856301 GTGTCCCCGCGCACCAGCCCCGG - Exonic
936153420 2:110033730-110033752 CCGCCCAGGCACACCTGCCCTGG + Intergenic
936191261 2:110337685-110337707 CCGCCCAGGCACACCTGCCCTGG - Intergenic
937070652 2:119060663-119060685 CCCCACCCACCCACCGGCCCCGG - Intergenic
937854109 2:126660357-126660379 CCTCCCTCACGCACCGTCCCAGG + Intronic
938058244 2:128233036-128233058 CCGCCGCCGCGCTCCCGCCTCGG - Intergenic
939580137 2:143937456-143937478 ACGCCCCGGCACGCCGGCCCCGG - Intergenic
944495864 2:200306867-200306889 GCGCCCCCGGGCCCCGGCTCCGG + Intronic
945245255 2:207711710-207711732 CCCGCCCCGCGGCCCGGCCCCGG - Intronic
946404059 2:219483525-219483547 CAGCTCCCGCGGCCCGGCCCGGG - Exonic
948115728 2:235493712-235493734 CGGCCCCCGCGCCCCGGCACGGG - Intergenic
948205198 2:236159773-236159795 CCGCCCCCCCACCCCGGGCCCGG + Intergenic
948216541 2:236237342-236237364 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216556 2:236237367-236237389 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216571 2:236237392-236237414 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216585 2:236237417-236237439 CTCGCCCCGCGCCCCGGCCCCGG - Intronic
948645221 2:239400431-239400453 CCACCCCCGCGCCCCCGCCCCGG + Exonic
948844217 2:240675550-240675572 CAGCCCCAGCGCCCCTGCCCGGG + Intergenic
948849643 2:240699329-240699351 CAGCCCCAGCGCCCCTGCCCGGG - Intergenic
948886691 2:240888371-240888393 CCCCCGCCGCGCATCGGCTCCGG - Exonic
948945660 2:241217898-241217920 CCCGCCCCGCGCTCCCGCCCGGG - Intronic
948983831 2:241508362-241508384 CCGCCACCGAGCCCCGCCCCGGG + Intronic
949038406 2:241832051-241832073 CCCCTCCCGCCCACAGGCCCCGG - Intergenic
1168838701 20:894997-895019 CCGCCCACCAGCACAGGCCCTGG + Intronic
1168886956 20:1266605-1266627 CCGCCCGCGCTCACCCGCCCCGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169065487 20:2692624-2692646 CCGCCGCCGCGGCCCGGGCCCGG + Intergenic
1170156616 20:13274671-13274693 CCCCCCCCGCGCCCGGCCCCCGG + Intronic
1170629771 20:18056962-18056984 CCGCCGCCCCGCCCCGGACCTGG + Intronic
1171974851 20:31587907-31587929 TCGCCCCCGCCCGCCGGGCCTGG + Intergenic
1172363229 20:34329481-34329503 GCGCCACCGCACTCCGGCCCAGG + Intergenic
1174736713 20:52972195-52972217 GGGCCCCGGCGCGCCGGCCCAGG - Intergenic
1175375192 20:58519313-58519335 CCTCCCCCTAGCACCGGCCATGG - Intergenic
1175612001 20:60359212-60359234 CCGCCCCTGCACACCTGCACTGG - Intergenic
1175926802 20:62475255-62475277 CCCCAGCCGCGCACCCGCCCGGG - Exonic
1176068846 20:63215814-63215836 CAGACCCCGCGCCTCGGCCCCGG + Intronic
1176131651 20:63498977-63498999 CTGCCCCCCAGGACCGGCCCCGG + Intronic
1176194361 20:63830726-63830748 CCGCCGCCGCGCTCCCTCCCCGG - Intronic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176611289 21:8987661-8987683 CAGCGCCCGCGCACCGGTCCCGG - Intergenic
1178518194 21:33266294-33266316 CAGGCCCCGCCCACCAGCCCGGG - Intronic
1178948391 21:36966676-36966698 CCGCCCCAGCGCCCCAGGCCCGG + Intronic
1179539711 21:42076254-42076276 CCGCCCCAGCCCAGCAGCCCTGG - Intronic
1179615814 21:42582506-42582528 CCGCTCCGGCCCACCAGCCCTGG - Intergenic
1179893704 21:44350287-44350309 TCGCGCCCTCGCCCCGGCCCCGG - Intronic
1179972882 21:44845993-44846015 CAGCCCCGGCGCTCCGGCCCAGG - Intergenic
1180008271 21:45033224-45033246 CCGCCGCCGCGCCCTGCCCCCGG + Intergenic
1180106657 21:45623120-45623142 CGGCCCCTGAGCACGGGCCCAGG - Intergenic
1180697373 22:17760679-17760701 CCACCCCAGCGCGCCGGGCCAGG - Intronic
1181082836 22:20425738-20425760 GCGGCCCCGCGCTCGGGCCCTGG + Exonic
1181265861 22:21630095-21630117 CCGCCCCGACGCACACGCCCAGG + Intergenic
1181361095 22:22336739-22336761 CAGCCCCCCCGGACAGGCCCTGG - Intergenic
1182321383 22:29480238-29480260 CCGGCCTCGCGCACCTGCTCAGG + Exonic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1182664051 22:31944621-31944643 CCGCCGCCGCGCACGCGCACTGG - Exonic
1182903904 22:33920602-33920624 CCGGCCCCGCGCCCCAGGCCGGG - Intronic
1183359340 22:37375504-37375526 GCGCCGCCGCGCACAGCCCCAGG + Exonic
1183504706 22:38202560-38202582 CCGCCCGCGGGCGCCGGGCCAGG - Intronic
1183672966 22:39283665-39283687 CCGCCCCCTCCCTCCGGCCAGGG - Intergenic
1183720130 22:39557766-39557788 CAGCACCCGCGCCCCCGCCCCGG + Intergenic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183788379 22:40045108-40045130 GCGCCTCCGCTCACCGCCCCGGG - Intronic
1183856081 22:40636248-40636270 CCGCCCGCCCGGCCCGGCCCGGG + Intronic
1184342216 22:43892149-43892171 CCGCCCCCACGCGCCCGCCCCGG + Intergenic
1184365238 22:44046950-44046972 CACCCCCCGCACACCGACCCAGG - Intronic
1184465883 22:44668730-44668752 CCGGCCCCGGGCTCCGGCTCCGG + Intronic
1184680788 22:46071337-46071359 CCGCCCGCGCGCGCCGTCCCGGG + Intronic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185285832 22:49999624-49999646 CCACCTCCGCGCCCCGCCCCCGG - Intronic
1185285852 22:49999664-49999686 CCACCTCCGCGCCCCGCCCCCGG - Intronic
1185285874 22:49999704-49999726 CACCCCCCGCGCCCCGCCCCCGG - Intronic
1185314537 22:50173370-50173392 CTGCCCCCGAGCACCCTCCCAGG + Intronic
1185340985 22:50290995-50291017 CGGCCCCAGCGCACAGGCTCAGG + Intronic
1203252723 22_KI270733v1_random:125419-125441 CAGCGCCCGCGCACCGGTCCCGG - Intergenic
950018408 3:9769782-9769804 CCGCCCCCACGCAGCGCCCAGGG + Intronic
950316313 3:12004657-12004679 CCGCCGCCGCCCCCCGGTCCGGG + Exonic
950400965 3:12768917-12768939 CCCCCGCCCCGCCCCGGCCCCGG - Intronic
952816763 3:37453032-37453054 CCCACCCCGCGCAGCGGCGCTGG - Intronic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
954305699 3:49724206-49724228 CCGGCCCCGCCCCACGGCCCCGG + Intergenic
954538971 3:51381400-51381422 CCACCCCCGCCTGCCGGCCCTGG + Exonic
955140103 3:56260437-56260459 TCGCCCCCGCGCCCCAGCCCTGG + Intronic
958814567 3:98901533-98901555 CCTCCCCTGCGCTCCGGCCTGGG - Exonic
960167062 3:114414943-114414965 CCGCCCCCCCGCACCCACCCAGG + Intronic
961202575 3:125056158-125056180 CCGGCCCCGCGCGGCGGGCCCGG + Intergenic
961260077 3:125595296-125595318 CCGGCTGCGCGCGCCGGCCCTGG - Intergenic
961300078 3:125916531-125916553 CTGCCCCCGCGCACTGCCCTGGG + Intergenic
961539437 3:127590073-127590095 CCGCCACCCCGCGCCGGACCGGG + Intronic
961648917 3:128407832-128407854 CCACCCCCGTGCTCAGGCCCTGG - Intronic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
964438141 3:156675120-156675142 CCTCCCCCGCGGGCCGACCCCGG + Exonic
964801601 3:160564942-160564964 CCGGCCCCTCGCACCCGCGCCGG + Intronic
965962055 3:174440904-174440926 TCGCCCCCGAGCGGCGGCCCCGG - Intronic
966372134 3:179261331-179261353 CCCCCCCCGCGGGCCGGGCCAGG + Intronic
966411857 3:179653169-179653191 CAGACCCCGCGCTCCGGCTCCGG + Exonic
966684828 3:182682730-182682752 CGCCCCCCGCGCGCCGGCCCGGG + Intergenic
966732525 3:183162784-183162806 CCCTCCCCGCCCAGCGGCCCTGG - Exonic
966852742 3:184174831-184174853 CCGCCGCCCCGCCCCGGCCCCGG - Intronic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
966868583 3:184276086-184276108 CCGCTCCCGGGCCGCGGCCCCGG - Intronic
966905847 3:184525552-184525574 CGGCCCCCGGCCCCCGGCCCCGG - Intronic
966919374 3:184602042-184602064 CCGCCCGCGGGCCCCAGCCCCGG - Intronic
967493651 3:190120427-190120449 CCGCCCCCGCCCCCCGGCGAGGG - Exonic
968051584 3:195658308-195658330 GCTCCCCCTCGCACCGGCCCAGG - Intergenic
968104232 3:195990025-195990047 GCTCCCCCTCGCACCGGCCCAGG + Intergenic
968302533 3:197627615-197627637 GCTCCCCCTCGCACCGGCCCAGG + Intergenic
968323443 3:197791532-197791554 CCCGCCCCGCTCACCCGCCCGGG - Exonic
968410573 4:386528-386550 CCGCAGCCGCGCACCTTCCCTGG + Intergenic
968659505 4:1793285-1793307 CCGCCACCGCGCACTGAGCCTGG - Intronic
968702061 4:2061954-2061976 CCACCCCCGCGCCACGGCCTTGG + Intronic
968804591 4:2764026-2764048 CCTCCTCCGCGCCCAGGCCCTGG - Intergenic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
969378942 4:6782255-6782277 CTGCCGCCGCGCCCCGCCCCCGG - Intronic
969756431 4:9153203-9153225 CTGCCCCCGCGCACTGCCCTCGG + Intergenic
969848002 4:9934811-9934833 CAGCCCCTGCCCACAGGCCCTGG + Intronic
970411577 4:15813602-15813624 CCACCCCCGCCGACAGGCCCCGG + Intronic
971771911 4:30908086-30908108 CCTCACCCCCGAACCGGCCCTGG - Intronic
972533054 4:39977572-39977594 CCGCCGCCGCCCGCCCGCCCGGG + Exonic
972543122 4:40056637-40056659 CCGCCTCGGCGCGGCGGCCCGGG - Intergenic
974742562 4:66025049-66025071 CCGCACCCCCGAACTGGCCCCGG - Intergenic
975666794 4:76741100-76741122 CCGCCTCCCCGCACACGCCCCGG + Exonic
975883553 4:78939234-78939256 CCGCCGCCGCTCCCCGGCTCGGG + Exonic
976246750 4:83012655-83012677 CCGCCAAGGCCCACCGGCCCGGG + Intronic
979205544 4:118033557-118033579 CGGCCCGCGCGCGCCCGCCCCGG - Intergenic
979624140 4:122827096-122827118 CCGTCCCCCGGCCCCGGCCCCGG - Exonic
983940305 4:173529620-173529642 CTGCCTCCGCGCAGCAGCCCGGG - Exonic
984803741 4:183735852-183735874 CCCCCCCCTCCCCCCGGCCCGGG + Intergenic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
985129099 4:186723882-186723904 CCGGCCCCGCCCGCCGGCGCCGG + Intronic
985264357 4:188144403-188144425 GCGCCCCTGCGCTCCAGCCCGGG - Intronic
985497646 5:218561-218583 GCTTCCCCTCGCACCGGCCCAGG - Intronic
985611648 5:892721-892743 CCGCCACCGCCCCCTGGCCCTGG + Exonic
985727272 5:1523150-1523172 CCGCCCGCGCGCCCTGTCCCGGG + Intronic
989146963 5:38258638-38258660 CCACCTCCTCGCCCCGGCCCGGG + Exonic
990888740 5:60624899-60624921 CCGACCCCCCACACAGGCCCCGG + Intronic
992226217 5:74621670-74621692 CCCCCCCCGCCCCCCGCCCCCGG + Intergenic
992365407 5:76084557-76084579 CCGCCCCCGCGCGCCGCCTAAGG - Intronic
992741090 5:79774305-79774327 CAGCCCCCGCGCACAAGCCGGGG - Intronic
994107363 5:95961900-95961922 CCGGCCCCGCGCCCCGCCCCGGG + Exonic
994367051 5:98928582-98928604 CCTCCCCCGCGCCCAGGCCCGGG + Exonic
994378629 5:99043603-99043625 CCGCACCCGCTGACAGGCCCTGG - Intergenic
997204423 5:132035668-132035690 GCGCCACCGCTCACCGGCCTGGG + Intergenic
997453904 5:134004225-134004247 CCGCCCACGCTCGCCGGACCAGG - Intronic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
997521470 5:134526644-134526666 GCGCCCGCGTGCACCGGGCCGGG - Intronic
998130285 5:139648331-139648353 CCGCCGCCGCGCGCCCGCCCGGG - Exonic
999252316 5:150190212-150190234 CGGCTCCCGCGCACCGGCTGGGG - Exonic
999300263 5:150486305-150486327 GCGCCTCCGGGCTCCGGCCCGGG - Intronic
999300356 5:150486554-150486576 CCACCCCCGCGCGCGGGGCCCGG - Intronic
1000907358 5:166978850-166978872 CCGAGAGCGCGCACCGGCCCAGG - Intergenic
1002058101 5:176610152-176610174 CCCGCCCCGCGCCCCGCCCCGGG + Intergenic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002102886 5:176866098-176866120 CCGCCCAGGCCCACTGGCCCGGG + Intronic
1002190214 5:177473804-177473826 CCGCCCCTGCGCGCCGCTCCAGG + Intronic
1002524227 5:179806638-179806660 CGACCCCTGCGCCCCGGCCCCGG - Intronic
1004262065 6:14117536-14117558 CCGCCCCCGCGCGCCCGGGCCGG - Intronic
1004627926 6:17393938-17393960 CCGCGCCCGCGCCCCGCGCCCGG - Intronic
1004660643 6:17706462-17706484 CCTCCCCCGCCGCCCGGCCCCGG + Exonic
1004690229 6:17987296-17987318 CCGCCCCGGCCCCCCGGCCCCGG + Intronic
1006472956 6:34238255-34238277 CCCCCCGCGCGCCCTGGCCCCGG + Intronic
1006932801 6:37697751-37697773 CCGCCCCCGCCCGGCGGCCTTGG + Exonic
1007320947 6:41028413-41028435 GCGCCCCCGCGCTCGGGGCCTGG + Exonic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007625380 6:43243618-43243640 CCCCCGCCCCGCCCCGGCCCCGG + Intergenic
1007633472 6:43285189-43285211 CCTCCCCCTCGCACCAGGCCCGG + Exonic
1008941157 6:57046962-57046984 CCGGCCCCCCGCACGGGCCCTGG + Intronic
1008945346 6:57090460-57090482 CCGGCCCCCCGCACGGGCCCTGG + Intronic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1010601508 6:77833789-77833811 CCGCACCCGCCAACAGGCCCAGG + Intronic
1011252703 6:85389643-85389665 CCGCCCGCGCACACCCTCCCTGG - Intergenic
1014035850 6:116765738-116765760 CCGCCCCCGGCCAGCGACCCGGG + Intergenic
1014798209 6:125749293-125749315 CCGCCCCCGCGCGCCCGCGTTGG + Intronic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1015845810 6:137519730-137519752 CCGCCCCCCCGCCCCTGCCATGG + Intergenic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1017662420 6:156687442-156687464 CGGCCCCCACGCCCCGGCCGCGG + Intergenic
1017665931 6:156720160-156720182 CAGCCGCCCAGCACCGGCCCAGG + Intergenic
1017842289 6:158232036-158232058 CCGCCCTCCCTCCCCGGCCCAGG - Intergenic
1017954845 6:159169332-159169354 CCGGCCCCGCACACCGGCAGGGG + Intergenic
1018331060 6:162727777-162727799 CCGCCCCCGCGCCCGGCCCTAGG + Intronic
1019198650 6:170296628-170296650 CCGGCCCCGCCCGCCGACCCCGG - Intronic
1019451614 7:1101603-1101625 CAGCCTCCGCGCAGCCGCCCAGG + Intronic
1019473400 7:1232973-1232995 GCGCCCCCGCGCCCCGCCACCGG + Exonic
1019707878 7:2505059-2505081 CCGCCTCCCCGCAGAGGCCCTGG + Intergenic
1019719299 7:2558910-2558932 CAGCCCCCGCGCTCCGCCCCGGG + Intergenic
1020008071 7:4792673-4792695 CGGCCCCGGCTCAGCGGCCCTGG - Intronic
1020080347 7:5283162-5283184 CCGCCCCCTCCCGCCCGCCCGGG + Intronic
1020086812 7:5315009-5315031 CCGCCCACGCCCACGGGCCTTGG + Exonic
1020252943 7:6483953-6483975 CCCCCGCCGCTCACCGGCGCAGG + Exonic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1021969230 7:25950941-25950963 CCGCCCGTGCACCCCGGCCCGGG - Intergenic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1024262416 7:47582203-47582225 CCGCGCCCGCGCCCCGAGCCTGG + Intronic
1026010066 7:66629282-66629304 CCGGCCCCGCCCACCCGCCGAGG - Intronic
1026360460 7:69598111-69598133 CCGCCCCAGCGCGCATGCCCTGG + Intergenic
1026787816 7:73312955-73312977 CTGCCCCCGCCCAGCGGGCCTGG - Exonic
1026840383 7:73667629-73667651 CTGCGCCCCAGCACCGGCCCTGG - Intergenic
1029127329 7:98303619-98303641 CCGCCACCGCACAGAGGCCCTGG - Intronic
1029374930 7:100171678-100171700 CCGCCCCCTCTCGCCCGCCCAGG - Exonic
1029456180 7:100673707-100673729 CCGCCGCCGCGCCCAGGACCCGG - Exonic
1030033475 7:105388993-105389015 CCGCCCCCACCCGCCGGCCCCGG + Intronic
1031918603 7:127585371-127585393 CCGCCCCAGCCCTCCGGGCCTGG - Exonic
1032130720 7:129225251-129225273 CGGCCCCCGGTCCCCGGCCCGGG + Exonic
1032194428 7:129780958-129780980 CCGCGTCCGCGCCCCAGCCCCGG - Intergenic
1033220474 7:139523887-139523909 CCGCGCCCGCGCTCCTGCACCGG - Exonic
1034342714 7:150368684-150368706 GGGCGCCCGCGCCCCGGCCCCGG + Intronic
1034441049 7:151086341-151086363 CCCCTCCTGCGCGCCGGCCCGGG - Intronic
1034951128 7:155297781-155297803 CCGCCCGCGCGCACCGCCCAGGG - Exonic
1035153206 7:156892622-156892644 CCGCCCCCGCCCCGCGGCCTCGG - Intronic
1035227817 7:157443288-157443310 CCGCCCCCCCACCCCGACCCGGG + Intergenic
1036871262 8:12436415-12436437 CTGCCCCCGCGCACTGCCCTCGG - Intergenic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037450800 8:19014009-19014031 CCGCAGCCGCGCGCCCGCCCTGG + Intronic
1038575567 8:28701341-28701363 CCGGCCCCGCGCCCCTGACCCGG + Exonic
1039903166 8:41767289-41767311 CGATCCCCGCGCCCCGGCCCCGG + Intronic
1039950891 8:42171923-42171945 CCGCCACTGCACACCAGCCCGGG - Intergenic
1040445669 8:47490833-47490855 CCGCACCCTAGCACAGGCCCTGG - Intronic
1040569084 8:48592339-48592361 CCTCCTCTGCACACCGGCCCTGG + Intergenic
1041355309 8:56993655-56993677 CAGCCGCCGCGCTCCGGGCCAGG + Exonic
1045098985 8:98825985-98826007 CCGGCCCCGCCCACCCGCCGCGG - Intronic
1045432050 8:102123811-102123833 CCGGCCCCCGGCCCCGGCCCCGG + Intronic
1046547438 8:115669120-115669142 CCGCCCGCCGGGACCGGCCCCGG + Intronic
1047319671 8:123768062-123768084 CCGCCCCGTCTCACTGGCCCGGG + Intergenic
1047951560 8:129939698-129939720 CCGCTCCCCCGCTCCGGACCCGG - Exonic
1047998611 8:130358714-130358736 CCCCGCCCGCGCCCCGCCCCCGG + Intronic
1048553980 8:135457622-135457644 CGGCCCCCGCGCTCCGGGCGCGG - Exonic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1049419573 8:142510829-142510851 GCGGCTCCGCGCCCCGGCCCCGG - Intronic
1049643649 8:143726654-143726676 CTGCCCCTGCGCTCCGGCACGGG + Exonic
1049718173 8:144103539-144103561 CCGCCCCCACTCACCGCCCCAGG + Exonic
1049756633 8:144313791-144313813 CCGCCTCCCCGCCCCGCCCCCGG + Intronic
1049791642 8:144475124-144475146 CCGCCCCCGGGCTCCGACCCTGG + Intronic
1049803179 8:144527502-144527524 CCGCCCGCACGCTCCGGCGCCGG + Exonic
1049803565 8:144529019-144529041 CCGCCTCCGCGACCCGGGCCCGG + Exonic
1053129236 9:35605689-35605711 CCGCCCGTGCCCCCCGGCCCCGG - Exonic
1053786335 9:41655232-41655254 CCGGCCCCGGACCCCGGCCCAGG - Intergenic
1053786344 9:41655245-41655267 CCGCCCCCGCCTCCCGGCCCCGG - Intergenic
1054175049 9:61869176-61869198 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1054662488 9:67711617-67711639 CCGGCCCCGGCCCCCGGCCCCGG + Intergenic
1055612006 9:78032360-78032382 CTGCCTCAGCCCACCGGCCCGGG + Intergenic
1056747001 9:89311464-89311486 CGGCCCTCGCCCTCCGGCCCCGG - Intronic
1057259565 9:93576360-93576382 CCGCCTCCGCCCGCCGGCCTGGG - Intergenic
1057509987 9:95669863-95669885 CCGACCCCACGCACCGGTCTTGG - Intergenic
1057773352 9:97985072-97985094 CCCCCGCCGCGGACCGGCGCGGG + Intronic
1057904773 9:98975096-98975118 CCGCTGCCGCGCACGGTCCCGGG + Intronic
1058908124 9:109497993-109498015 CCGCCCGCGCCCTCCCGCCCCGG + Intronic
1059483777 9:114611741-114611763 CCTCCCCCGCGTGCCGGCCGTGG + Intronic
1060478128 9:124000176-124000198 CGCCCCCCGCCCCCCGGCCCTGG + Intergenic
1060478135 9:124000182-124000204 CCGCCCCCCGGCCCTGGCCCGGG + Intergenic
1061003798 9:127917054-127917076 CCGCCCCTCCTCGCCGGCCCCGG - Intergenic
1061095840 9:128456412-128456434 CCCGCCCCGCCCACCGGCGCGGG + Exonic
1061237778 9:129352309-129352331 CCGCCCCCTCGCCCTGGCCGCGG + Intergenic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1061293717 9:129666174-129666196 CGGACCCCGCGCCCCGGCCCCGG - Intronic
1061321726 9:129835251-129835273 GCGCCTCTGCGCAGCGGCCCAGG + Exonic
1061365980 9:130172623-130172645 CCGCCCCCCCGGGCCGGACCCGG - Exonic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061559655 9:131394281-131394303 CCGCCCCCACGCCCCGGCCCCGG - Intronic
1061580284 9:131531771-131531793 CCGCCCCCCCGCTCCGTGCCTGG + Intergenic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1061975964 9:134068159-134068181 CCGGCGCCGCGCCCCGCCCCGGG + Intronic
1062197959 9:135285027-135285049 CTGCCCCCGAGCTCCAGCCCAGG - Intergenic
1062230632 9:135479885-135479907 CCCTCCCCGCGCCCCGGCCGAGG + Exonic
1062425270 9:136503373-136503395 CCTCCCCCGCCCACCGGCCAGGG + Intronic
1062560764 9:137140913-137140935 CCACCCCCGTGCCCCAGCCCAGG + Intronic
1062571763 9:137189013-137189035 CCGCCGCCGCGCTCCTGCCCTGG + Intronic
1062595035 9:137295648-137295670 ATGCCCCCGCGGACCGGGCCGGG + Intergenic
1062618073 9:137407075-137407097 CCGCCCCCGCCCGCCCGCTCCGG - Intronic
1062621256 9:137423459-137423481 CCGCCGCCTGGCCCCGGCCCCGG + Exonic
1062629521 9:137457604-137457626 CAGCCCCTGCGCGCCAGCCCTGG - Exonic
1185504044 X:619192-619214 CCTCCCCCGCACTCCGGCCCGGG + Intergenic
1186029984 X:5357368-5357390 GCGCCCCTGCGCTCCAGCCCGGG + Intergenic
1186670018 X:11758408-11758430 CCGCCCCCGCCCCCGGTCCCGGG - Intronic
1189335576 X:40168914-40168936 CCTCCCCCGCCCGCCCGCCCTGG + Intronic
1190008190 X:46759368-46759390 CCGTCCTGGCGCACCTGCCCAGG + Intergenic
1190266881 X:48831955-48831977 CCGCCGCGGCGCTCCGACCCCGG - Exonic
1192561705 X:72131761-72131783 CCGCCCGCCCTCTCCGGCCCCGG - Exonic
1195138150 X:101931687-101931709 CCGCCCCCGCACCCCGGGACGGG + Intronic
1195716870 X:107826438-107826460 GCGCCCCCTCGCCGCGGCCCTGG + Intronic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1199595825 X:149505112-149505134 CCGCCACCCCGGACCGGCCGAGG - Intronic
1200000280 X:153056568-153056590 CCGCCGCCGCGCATAGCCCCCGG + Intronic
1200229421 X:154436810-154436832 CCACCCCCGCCCACCCCCCCGGG - Intergenic
1201176016 Y:11308528-11308550 CCACCCCCACCCACCAGCCCCGG + Intergenic