ID: 1014801037

View in Genome Browser
Species Human (GRCh38)
Location 6:125778177-125778199
Sequence TTGGTGATAATTAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014801037_1014801047 28 Left 1014801037 6:125778177-125778199 CCTTCTACCCTAATTATCACCAA No data
Right 1014801047 6:125778228-125778250 TTAGTTGTGCTGCCTCTGTGGGG No data
1014801037_1014801045 26 Left 1014801037 6:125778177-125778199 CCTTCTACCCTAATTATCACCAA No data
Right 1014801045 6:125778226-125778248 ATTTAGTTGTGCTGCCTCTGTGG No data
1014801037_1014801046 27 Left 1014801037 6:125778177-125778199 CCTTCTACCCTAATTATCACCAA No data
Right 1014801046 6:125778227-125778249 TTTAGTTGTGCTGCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014801037 Original CRISPR TTGGTGATAATTAGGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr