ID: 1014802847

View in Genome Browser
Species Human (GRCh38)
Location 6:125796338-125796360
Sequence CTGATTTATATTGAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014802847_1014802857 13 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802857 6:125796374-125796396 TCGTGCAGGGGATTGGTTCCAGG 0: 1
1: 0
2: 3
3: 65
4: 272
1014802847_1014802851 -1 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802851 6:125796360-125796382 GTAGTCCCTCAGTATCGTGCAGG No data
1014802847_1014802860 27 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802860 6:125796388-125796410 GGTTCCAGGTAGTGGGTTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 184
1014802847_1014802856 6 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802856 6:125796367-125796389 CTCAGTATCGTGCAGGGGATTGG No data
1014802847_1014802858 19 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802858 6:125796380-125796402 AGGGGATTGGTTCCAGGTAGTGG 0: 1
1: 0
2: 0
3: 18
4: 244
1014802847_1014802853 1 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802853 6:125796362-125796384 AGTCCCTCAGTATCGTGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1014802847_1014802859 20 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802859 6:125796381-125796403 GGGGATTGGTTCCAGGTAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 200
1014802847_1014802852 0 Left 1014802847 6:125796338-125796360 CCACCCACCTCAATATAAATCAG 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1014802852 6:125796361-125796383 TAGTCCCTCAGTATCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014802847 Original CRISPR CTGATTTATATTGAGGTGGG TGG (reversed) Intronic
904171752 1:28596158-28596180 CTGTTTTATTTTGTGGGGGGTGG + Intronic
906482196 1:46206396-46206418 CTGATTTATATTGAGCAATGAGG + Intronic
909279308 1:73728462-73728484 CAGAGTTATATGGAGTTGGGTGG + Intergenic
910917130 1:92301003-92301025 CTAATTTAGTTGGAGGTGGGTGG + Intronic
910985209 1:92998532-92998554 CTGATTTGCTTTGTGGTGGGAGG + Intergenic
911941004 1:104047928-104047950 ATGTTTTATATTGAGCTGTGAGG + Intergenic
912073859 1:105848176-105848198 CTGATTTTTATTAAGGTGGTTGG - Intergenic
912822158 1:112876686-112876708 CTGGTGTCTATTGAGGAGGGAGG + Intergenic
915972959 1:160366965-160366987 CTGTTTAATATTGATGAGGGGGG + Intergenic
916431051 1:164728814-164728836 CTGAAATATGTTGCGGTGGGTGG - Intronic
919399742 1:197097665-197097687 CTGATTAAGACTGAGGTGGCAGG - Intronic
924749639 1:246874020-246874042 GTGAGTTGTATTGAGGTGGCAGG - Intronic
1063065643 10:2605882-2605904 CTGGGTTTTATGGAGGTGGGAGG + Intergenic
1068543156 10:58318915-58318937 TTGCTTTGTTTTGAGGTGGGCGG + Intergenic
1070584335 10:77750327-77750349 CAAACTTCTATTGAGGTGGGTGG + Intergenic
1073032269 10:100536121-100536143 CTTATTGAGAATGAGGTGGGGGG + Exonic
1073567336 10:104546352-104546374 TAACTTTATATTGAGGTGGGTGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077773386 11:5245343-5245365 CACATTTATATTGAGTTGTGGGG + Intergenic
1080056189 11:27909101-27909123 CTTATTTTGATAGAGGTGGGGGG - Intergenic
1081944989 11:46984024-46984046 CTGATTGGTATGAAGGTGGGGGG + Intronic
1082674034 11:56073412-56073434 CTGATAGAAATTGAGGTGGTTGG + Intergenic
1090066412 11:123507565-123507587 CTGATTCAAATTGAGGTAAGGGG - Intergenic
1092521061 12:9273663-9273685 GTGGTTTATATTGAGGTAAGTGG - Intergenic
1092934843 12:13351150-13351172 CTGGTTTATATCAAGGTGGGAGG + Intergenic
1095100802 12:38181602-38181624 CTGTTTTATATTGCTGTTGGGGG - Intergenic
1096626479 12:52899004-52899026 CTCATTTAATTTGAGCTGGGGGG - Intronic
1096861170 12:54529430-54529452 CTGATTTATATGGAGGTGAGAGG - Intronic
1096932665 12:55231029-55231051 CTGGTTTATATTTAAGTGTGAGG - Intergenic
1100747375 12:97661084-97661106 ATGATTTATTTTGAAATGGGAGG - Intergenic
1101777953 12:107810717-107810739 CTGGAGTATATGGAGGTGGGTGG + Intergenic
1102577152 12:113863037-113863059 CTAATTTCTTTTGAGGTGTGTGG + Intronic
1103757011 12:123216249-123216271 CAGATTTATATTGAAGAGGAGGG - Intronic
1107838282 13:44429993-44430015 CTGATTTATTTTGAGCTGAAGGG + Intergenic
1110104389 13:71652981-71653003 CTCATTTATCTCGAGTTGGGAGG - Intronic
1112438412 13:99408066-99408088 CTGCTTGATGTTGAGGTGGTAGG + Intergenic
1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG + Intronic
1116661474 14:47716328-47716350 ATGATTTATTTTTTGGTGGGGGG + Intergenic
1117148300 14:52857911-52857933 CTGATTTATTTGGGGGTAGGGGG + Exonic
1118749333 14:68795062-68795084 ATGATTTAAATTAAGGTGGATGG - Intronic
1119126497 14:72132129-72132151 CTGATTAATTTAGAGGTGGGAGG + Intronic
1125705574 15:41732582-41732604 CTTACTTATTGTGAGGTGGGAGG + Intronic
1127225973 15:56929651-56929673 CTAATTTTTATTGCAGTGGGTGG + Intronic
1130094516 15:80846055-80846077 GAGATTTACACTGAGGTGGGTGG - Intronic
1130626176 15:85517725-85517747 TTTATTTATATGGGGGTGGGGGG + Intronic
1133085939 16:3363580-3363602 ATTATATATATTGTGGTGGGGGG + Intergenic
1133970526 16:10564582-10564604 ATGATTGATAATGAGGTAGGAGG - Intronic
1137072615 16:35918085-35918107 CTTCTTTATATTCAGCTGGGTGG - Intergenic
1137072660 16:35918776-35918798 CTTCTTTATATTAAGCTGGGTGG - Intergenic
1138706587 16:58921297-58921319 CAGATTCATAATGAGGTGTGAGG + Intergenic
1141830200 16:86506011-86506033 CAGATTTGTTTTGGGGTGGGAGG + Intergenic
1144239579 17:13297061-13297083 CTCAGTTAGATTGAAGTGGGTGG + Intergenic
1146123351 17:30213622-30213644 CTGATTTTTTTAAAGGTGGGAGG - Intronic
1146133574 17:30298422-30298444 CTGATTTAGAATGACCTGGGTGG + Intergenic
1146338288 17:31994757-31994779 CTGATTTTTACTGATGTTGGAGG + Intronic
1152606204 17:81291869-81291891 CTGGTTTGAACTGAGGTGGGTGG - Intronic
1154276133 18:12962222-12962244 CTTATTTTTATAGAGATGGGGGG - Intronic
1155456864 18:26026168-26026190 TAGATTTTTATAGAGGTGGGGGG + Intronic
1155930886 18:31706980-31707002 CTGATATGTATGGGGGTGGGAGG + Intergenic
1156092110 18:33484223-33484245 CTGATGTATATTCACATGGGTGG + Intergenic
1156900798 18:42298381-42298403 CTGCTTGATGCTGAGGTGGGAGG + Intergenic
1157308767 18:46536367-46536389 CTGATTGATTTTCAGGTAGGAGG - Intronic
1158890947 18:61871205-61871227 CTGTTTTTTTTTGGGGTGGGGGG - Intronic
1159224698 18:65517656-65517678 GTGATTTTAATTGTGGTGGGGGG - Intergenic
1164226696 19:23252147-23252169 CTGTTTTATTTTGTGGTGTGGGG + Intergenic
1164488758 19:28686892-28686914 CTGATATCTGTTGAGGTTGGAGG - Intergenic
1164565051 19:29319761-29319783 CTGATTTATCTTGTTGTGTGTGG - Intergenic
1167974426 19:53213040-53213062 CTGATGTATAGTGAGGTGAGAGG - Intergenic
928068234 2:28188334-28188356 CTGATTTACTCTGGGGTGGGCGG + Intronic
928712760 2:34025780-34025802 CTTGTTTACATTGAGGTGGTTGG + Intergenic
932838589 2:75060634-75060656 GTGATTTATTTTGAAGTTGGTGG + Intronic
933592681 2:84250131-84250153 CTACTTTATTTTGAGGTAGGAGG - Intergenic
938172003 2:129087595-129087617 CATATTTGTACTGAGGTGGGAGG - Intergenic
938191686 2:129288194-129288216 TTGATGTATATTGATGTTGGTGG - Intergenic
939819596 2:146940276-146940298 GTGATTTATTTTGAGGTGTCCGG + Intergenic
939977867 2:148739993-148740015 CTTCTTTATGTTGAGGTGGGAGG + Intronic
941160042 2:162025629-162025651 CTGATTTATAGTGAAGTGCATGG + Intronic
944651340 2:201833198-201833220 TTGATTTTTTTTGAGGGGGGGGG + Intronic
946327599 2:218992851-218992873 ATGATTTATCTTGCGATGGGTGG + Intronic
948991529 2:241558086-241558108 CTGATTTATGTTGAGATGTTGGG + Intergenic
1169527278 20:6442907-6442929 CTGTTTTATATTGCTGTTGGGGG + Intergenic
1169683294 20:8241764-8241786 CTGATTTCTACTGAGGTGGGAGG - Intronic
1169738594 20:8865437-8865459 ATGATTTATTTTGAGGTCAGGGG - Intronic
1170114477 20:12842282-12842304 CTGCTTTATTTTGAGGAGAGTGG - Intergenic
1172062062 20:32193440-32193462 CTGCATCATCTTGAGGTGGGAGG - Exonic
1172716441 20:36967773-36967795 CTGATGTATATTGAAAAGGGCGG + Intergenic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1174192543 20:48750489-48750511 ATTATTTATATTGAGGTGTGTGG - Intronic
1179094359 21:38299088-38299110 CTGATCTATACTTAGGTGGTCGG - Intronic
1181498713 22:23303029-23303051 GTGAATTAAATTGGGGTGGGGGG - Intronic
1181798765 22:25329981-25330003 CTGAAGTCTATGGAGGTGGGTGG - Intergenic
1185313410 22:50169045-50169067 CTGATTTATCTGGAGGTGCCTGG + Intergenic
950808475 3:15628900-15628922 CTGATTTAAAAAAAGGTGGGGGG - Intronic
953758910 3:45671643-45671665 CTGATATATATTAAAGTTGGAGG - Intronic
955874997 3:63479598-63479620 TTGATTAAGATTGAGGTGGCAGG + Intronic
956437742 3:69250682-69250704 TTGATTTATATTGAAGTTCGAGG + Intronic
957026596 3:75189157-75189179 CTGCTTTGTATTGAGGAGGGTGG + Intergenic
957740240 3:84256945-84256967 GTTATTTACATTGAGTTGGGGGG - Intergenic
960230508 3:115220571-115220593 CTGCTTTGTGTTGGGGTGGGTGG + Intergenic
960458581 3:117904037-117904059 CCTATTTAAATTGAGATGGGGGG + Intergenic
960983253 3:123251700-123251722 CTGATTTTCATTTAGGTGAGAGG - Intronic
961269065 3:125674021-125674043 CTGGTTTCCATTGTGGTGGGTGG - Intergenic
964266674 3:154904714-154904736 CTGTTTAATATTAATGTGGGAGG + Intergenic
965489170 3:169315637-169315659 CTGATTACTATTGAGGCTGGAGG - Intronic
973620382 4:52720509-52720531 TTGTTTTTTATAGAGGTGGGGGG + Intergenic
974696599 4:65383708-65383730 CTGATTTATAATAAGTTGGTAGG - Intronic
975081442 4:70285223-70285245 GTAACTTCTATTGAGGTGGGTGG - Intergenic
976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG + Intergenic
982647168 4:158038084-158038106 GTGTTTTATATTGAGCTGTGTGG - Intergenic
983151177 4:164283331-164283353 GTGTTTAATATTGAGGAGGGAGG - Intronic
984731752 4:183075045-183075067 GTGGCTTATGTTGAGGTGGGAGG + Intergenic
986142681 5:5046353-5046375 GTGATTTAAATTGAAGTTGGTGG + Intergenic
989214951 5:38894311-38894333 CAGATTTATATTGATATAGGAGG - Intronic
989408789 5:41093222-41093244 CTGGTTTATATTGAGATTTGGGG + Intergenic
989706785 5:44343019-44343041 CAGATTCAAATAGAGGTGGGTGG + Intronic
990353448 5:54941416-54941438 CTGCTTTTTTTTGAGGTGGTGGG - Intergenic
990631798 5:57678672-57678694 CTGACCCATTTTGAGGTGGGAGG + Intergenic
991109598 5:62883449-62883471 CTGACATTTTTTGAGGTGGGGGG + Intergenic
992272917 5:75084073-75084095 TAGAATTATATAGAGGTGGGTGG + Intronic
994722089 5:103392135-103392157 CTGATTTATCCTGAGGTGGTGGG + Intergenic
996285429 5:121785664-121785686 CTGTTTTGTATTGAGGGGTGTGG - Intergenic
999138990 5:149344989-149345011 CTGAAATATACTGAGGCGGGAGG - Intergenic
1001884523 5:175277452-175277474 CTCATCTATCTTGGGGTGGGAGG - Intergenic
1003235523 6:4292147-4292169 CTGATAAATATTGAGGTGTGTGG - Intergenic
1004019177 6:11761016-11761038 CTGGTTCAGATTGAGGAGGGAGG - Intronic
1004273170 6:14212579-14212601 GTCATTTATCTTGAGGTAGGTGG - Intergenic
1005834091 6:29694865-29694887 CTGATTTGTATTGAGGTGCGTGG + Intergenic
1007979029 6:46131074-46131096 CTAATTTAAGTGGAGGTGGGGGG - Intronic
1008260271 6:49358147-49358169 CTGATTAAGATTGGGGTGGTAGG + Intergenic
1011409255 6:87049594-87049616 CTGATTGGTATTGAGAAGGGAGG + Intergenic
1012270174 6:97199446-97199468 TTGATTTAAATGGAGGTGGGGGG - Intronic
1013991265 6:116256762-116256784 GTGTTTCATTTTGAGGTGGGTGG + Intronic
1014802847 6:125796338-125796360 CTGATTTATATTGAGGTGGGTGG - Intronic
1015083142 6:129252756-129252778 GTGTTTTATAGTGAGATGGGTGG - Intronic
1015155491 6:130090702-130090724 CTCAGTTATGCTGAGGTGGGAGG - Intronic
1016010250 6:139132071-139132093 CTCAGTTATGTAGAGGTGGGAGG + Intergenic
1016142517 6:140629955-140629977 CTGATTTATAATCAGAAGGGAGG - Intergenic
1018281193 6:162187516-162187538 GTGGTGTATATTGGGGTGGGGGG - Intronic
1021002929 7:15355980-15356002 CTGTTTACTATTGAAGTGGGTGG - Intronic
1021261616 7:18465456-18465478 CTGATTTCTGTGGAGGTGGGTGG + Intronic
1028545839 7:91998630-91998652 CTGATTTATATAGGGGAGTGGGG - Intronic
1029417304 7:100451034-100451056 ATGAGTTTTATTGGGGTGGGGGG - Intergenic
1030119013 7:106088161-106088183 CTGATTGCTATTTAGGTTGGTGG - Intergenic
1030714650 7:112793330-112793352 CTGTTTTATATTTAGGTGTCTGG - Intergenic
1031549830 7:123095202-123095224 CTGATTTATACTGAAGGGAGAGG + Intergenic
1031811912 7:126380710-126380732 TTTATTTTTATTGGGGTGGGAGG + Intergenic
1034845006 7:154436389-154436411 CTGATTTTTACTGAGGTGTTGGG - Intronic
1036945007 8:13086992-13087014 TTTATTTATTTTGAGATGGGGGG - Intronic
1042919760 8:73909618-73909640 CTGATTTGAACTGGGGTGGGGGG - Intergenic
1043994315 8:86793982-86794004 CAAATTTATAGTGAGGTGGCAGG - Intergenic
1051348414 9:16173846-16173868 TTGTTTTATTTTGAGGTGGTGGG + Intergenic
1052807995 9:33030152-33030174 CTGATATTTCTTTAGGTGGGAGG - Intronic
1054977132 9:71160951-71160973 TTGATTTACATTGAATTGGGAGG - Intronic
1055179671 9:73369409-73369431 AAGATCTATGTTGAGGTGGGTGG - Intergenic
1055376494 9:75654257-75654279 CTGATTAATACTGAGGTTAGGGG + Intergenic
1058360572 9:104142086-104142108 TTGATTTGTATTGAGGTGACTGG + Intergenic
1060045605 9:120337703-120337725 TTCTTTTATATTGAGGAGGGGGG + Intergenic
1061773111 9:132943398-132943420 CTGTTTAATGTTGAAGTGGGGGG - Intronic
1185825704 X:3247258-3247280 CTGCTTTCCACTGAGGTGGGTGG - Intergenic
1187121181 X:16407895-16407917 CTGATGTATTTTGAGTTGGCTGG + Intergenic
1188646191 X:32570092-32570114 CTGCTTGCCATTGAGGTGGGAGG - Intronic
1195057999 X:101165333-101165355 GTGATAAATGTTGAGGTGGGAGG + Intergenic
1195319468 X:103709990-103710012 GTGATTTGTATTGAAGTGAGAGG + Intronic
1199337224 X:146632458-146632480 GTTATTAATATTGAGGTGGTTGG - Intergenic