ID: 1014807431

View in Genome Browser
Species Human (GRCh38)
Location 6:125845848-125845870
Sequence ACCAAATATACACATAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014807431_1014807434 24 Left 1014807431 6:125845848-125845870 CCATATCTATGTGTATATTTGGT 0: 1
1: 0
2: 1
3: 32
4: 403
Right 1014807434 6:125845895-125845917 TGTTGTTTTTTCCACAAAAATGG 0: 1
1: 0
2: 3
3: 55
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014807431 Original CRISPR ACCAAATATACACATAGATA TGG (reversed) Intronic
904567908 1:31439000-31439022 TATAAATATACACATTGATATGG - Intergenic
905467852 1:38169127-38169149 ACCAACTATGCACATAAAGAGGG - Intergenic
905832823 1:41087070-41087092 CCCAACTATACACATAAATCTGG + Intronic
906834027 1:49063616-49063638 AACAAATATACAAACATATATGG + Intronic
908285347 1:62591895-62591917 AGCAGTTATACAAATAGATAAGG - Intronic
908361881 1:63376262-63376284 AACATATCTAAACATAGATAAGG + Intronic
908514555 1:64879213-64879235 ACCCAATATATGCAAAGATAAGG + Intronic
910459008 1:87428165-87428187 ACCAAAAATCAACATAAATATGG - Intergenic
911317063 1:96368445-96368467 AACACATATAAACATAGAAAAGG - Intergenic
911543257 1:99184425-99184447 ACCAAATATACATGTTGATATGG - Intergenic
911800034 1:102124946-102124968 ACCAAGTATTCGCAAAGATATGG + Intergenic
911840072 1:102670987-102671009 ACCACATATATAAACAGATACGG - Intergenic
912002678 1:104855423-104855445 AGCATATATATAGATAGATATGG - Intergenic
912867373 1:113269981-113270003 AAAATATATACACATAAATATGG + Intergenic
916691203 1:167191655-167191677 AGCAAATATGTACATACATAGGG - Intergenic
917616322 1:176748707-176748729 AACAAATCTAAACATAGAAAAGG - Intronic
918575662 1:186056124-186056146 ACCAAACATACACATACACAGGG + Intronic
918889621 1:190249287-190249309 ACCAAATATGCAAATAAATTTGG + Intronic
918970206 1:191404899-191404921 ACCAACTATTTACAAAGATAAGG - Intergenic
919098910 1:193069559-193069581 ACAAAATATAAACAGAGAAATGG + Exonic
920734870 1:208524244-208524266 ACCATATAAAAACATAGAGATGG + Intergenic
921173834 1:212575053-212575075 ATCAAATCTACAAATAAATATGG + Intronic
921656813 1:217749080-217749102 ACCAAACATACAAAGACATATGG - Intronic
922013562 1:221618949-221618971 ACACAATATTCACAAAGATAAGG - Intergenic
922522587 1:226269327-226269349 AACAAATATAAGCATAGAAAAGG + Intronic
922781770 1:228258051-228258073 ACAAAATATATACATATATTAGG - Intronic
923347511 1:233069767-233069789 ACTAAATATACACATTAAAAAGG + Intronic
1062891101 10:1060808-1060830 AACATATCTACACATAGAAAAGG - Intronic
1064892095 10:20187364-20187386 AACAATTATACACATTTATAGGG + Intronic
1065176749 10:23083972-23083994 AGCATATATAAACATAGAAAAGG - Intergenic
1066280007 10:33907179-33907201 ACCATATATATATATATATATGG + Intergenic
1066280008 10:33907180-33907202 ACCATATATATATATATATATGG - Intergenic
1066576403 10:36829997-36830019 ACTATATATACACAGACATAAGG + Intergenic
1067353473 10:45500000-45500022 ACCGAATATACAGATTGATTTGG + Intronic
1068372736 10:56139308-56139330 GCCAAATATAAACATTTATAAGG - Intergenic
1068425521 10:56857486-56857508 ACAATATATTCACAAAGATATGG - Intergenic
1068488663 10:57693748-57693770 GACACATATACACATATATATGG - Intergenic
1068488664 10:57693770-57693792 GACATATATACACATATATATGG - Intergenic
1068488674 10:57694006-57694028 GACATATATACACATATATATGG - Intergenic
1071236003 10:83649364-83649386 AACAAGAATACACACAGATACGG - Intergenic
1072271924 10:93785067-93785089 ACTACATATGCACATATATATGG - Intronic
1072394855 10:95028045-95028067 AGCATACATAGACATAGATATGG - Intergenic
1072556377 10:96517247-96517269 ACAAAACATACAAATAGACATGG + Intergenic
1073694991 10:105855515-105855537 ACCAATTAAACACTTATATAGGG + Intergenic
1077986856 11:7361023-7361045 TCCTAAAATACACATAGTTATGG + Intronic
1078172583 11:8939795-8939817 ACCAAAAATACAAATAAAAAAGG + Intergenic
1078281992 11:9911770-9911792 AACATATCTACACATAGAAATGG - Intronic
1080178837 11:29398507-29398529 AACAAATCTAAACATAGAAAAGG + Intergenic
1081187719 11:40065238-40065260 ACCATATATACACAAAAAAATGG - Intergenic
1081631012 11:44689947-44689969 AACACATATAGACATAGAAAAGG + Intergenic
1084194323 11:67515678-67515700 AACAAACATACACAAAGATGGGG + Intergenic
1085179980 11:74526039-74526061 AGCACATCTACACATAGAAAAGG - Intronic
1086245689 11:84749453-84749475 AACATATATACATATAGAAAAGG - Intronic
1086551118 11:88053003-88053025 AATATATATACACATATATATGG + Intergenic
1086820248 11:91427522-91427544 ACTAAATCTACACTTAGAAATGG - Intergenic
1086946316 11:92847241-92847263 AACAAATCTAAACATAGAAAAGG - Intronic
1087727185 11:101734126-101734148 AGCATATATAAACATAGAAAAGG - Intronic
1087889145 11:103517130-103517152 ACCATATCTAAACATAGATAAGG + Intergenic
1088235710 11:107720733-107720755 ACCAAATATACACATCCCTCAGG + Intergenic
1090021843 11:123135374-123135396 ACCATATATACATGTACATATGG - Intronic
1090536046 11:127642888-127642910 CCTATATATAGACATAGATATGG + Intergenic
1091082852 11:132688682-132688704 ACAAAATATAAAAATAGATTGGG + Intronic
1091551304 12:1536984-1537006 AACAAATCTAAACATAGAAAAGG - Intronic
1092177062 12:6417265-6417287 ACCAAATATGAGCAAAGATATGG + Intergenic
1093058776 12:14581291-14581313 ACCATATTTAAACATAGAAAAGG + Intergenic
1093356104 12:18169852-18169874 ACAACATATACATATAGATAAGG + Intronic
1093827959 12:23718122-23718144 ACCACATACACACATATTTATGG - Intronic
1094092647 12:26668363-26668385 ACAACAGATACACATGGATAGGG + Intronic
1095236511 12:39802760-39802782 ACCATATATAGATGTAGATATGG + Intronic
1096161507 12:49381954-49381976 ACCAAATTTAGACTTACATATGG - Intronic
1097446008 12:59672011-59672033 GCGATATATACACATATATACGG - Intronic
1097446009 12:59672040-59672062 GCGATATATACACATATATACGG - Intronic
1097601874 12:61703154-61703176 ACCACAGATACCAATAGATATGG + Intergenic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1098792258 12:74838186-74838208 CACAAATATACACAAAGAGAAGG - Intergenic
1099117094 12:78641446-78641468 TATAAATATACACATAAATAAGG + Intergenic
1099298260 12:80858322-80858344 ACCAATTATAAAAATAGGTAGGG - Intronic
1099977516 12:89561453-89561475 AACATATCTACACATAGAAAAGG - Intergenic
1104772072 12:131369712-131369734 TCCAAATGTGCACATACATAAGG + Intergenic
1106624581 13:31407323-31407345 ACCAAATAAACACCTATACATGG - Intergenic
1107087124 13:36437432-36437454 ATCAAATGTAGACAAAGATAAGG + Intronic
1107533397 13:41305912-41305934 AACACATAAACAAATAGATAAGG - Intergenic
1107866482 13:44708085-44708107 AATAAATATACAGATAGATCAGG - Intergenic
1108531073 13:51327971-51327993 AACAAATCTAAACATAGAAAAGG - Intergenic
1108585998 13:51870310-51870332 ATTAAAAATACACATAGAAAGGG + Intergenic
1108915619 13:55606603-55606625 AGCATATATAGACATAAATATGG + Intergenic
1108949408 13:56070709-56070731 ACCAGATCTACAAATAGAAAAGG + Intergenic
1109303219 13:60611082-60611104 AACAAAAATATACAGAGATAGGG - Intergenic
1109944551 13:69416249-69416271 AACATATCTACACATAGAAAAGG - Intergenic
1110252066 13:73391476-73391498 ACCAAAGAGAAATATAGATAAGG + Intergenic
1110279721 13:73678979-73679001 ACCAGGTAGACACATAGAAAAGG + Intergenic
1110717182 13:78719504-78719526 CACACATATACACATATATATGG + Intergenic
1111043069 13:82776760-82776782 ACCAAAAAGAAACATAGATCAGG - Intergenic
1111606930 13:90550323-90550345 AACATATATACACATACAAAAGG - Intergenic
1111954884 13:94746119-94746141 CACATATATACACATATATACGG + Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1114058507 14:18998209-18998231 TCCAAATATATGCATAGCTAAGG + Intronic
1114104039 14:19403545-19403567 TCCAAATATATGCATAGCTAAGG - Intronic
1114131129 14:19794228-19794250 ACCAAATATATATATTCATAAGG - Intronic
1114721142 14:24883161-24883183 TACAAACACACACATAGATATGG + Intronic
1116592606 14:46798131-46798153 ACAAAATATACACAAAACTAAGG - Intergenic
1117301663 14:54435694-54435716 ACCAAAGATAAAACTAGATATGG + Intronic
1119583453 14:75809341-75809363 AACAAAGATACTCATAGATTTGG - Intronic
1120515103 14:85461246-85461268 ACCATATATACATATATATATGG - Intergenic
1122457917 14:101869566-101869588 ACCAAATATTGACAAAGATACGG - Intronic
1122731998 14:103807336-103807358 AACAAATATATACATAGATCAGG - Intronic
1123574186 15:21649837-21649859 ACCAAATATATATATTCATAAGG - Intergenic
1123610802 15:22092422-22092444 ACCAAATATATATATTCATAAGG - Intergenic
1124102243 15:26706521-26706543 ACCTAATGTACACAAAGAAATGG + Intronic
1125347770 15:38736244-38736266 ACCATATCTAAACATAGAAAAGG - Intergenic
1126082601 15:44979873-44979895 ACCCAAGATATACAAAGATAAGG + Intergenic
1126506570 15:49411169-49411191 ACCAAATATTTACAAAGATTTGG - Intronic
1126675945 15:51159344-51159366 AACAATTAGACAAATAGATATGG + Intergenic
1126947283 15:53835733-53835755 AACAAATATACATACAGATTGGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127408415 15:58679385-58679407 TACATATATACACATATATATGG + Intronic
1127519744 15:59731771-59731793 ACCACATTTGCACAGAGATAGGG - Intergenic
1128431812 15:67603107-67603129 ACTAACTATACACTTAAATATGG - Intronic
1131755338 15:95554553-95554575 ACCAAACACACACATAGAATAGG + Intergenic
1131964525 15:97827433-97827455 ACCAAAAATACAAAAAAATAAGG + Intergenic
1132191967 15:99872230-99872252 ACAAAATATTCAAACAGATAAGG - Intergenic
1202983050 15_KI270727v1_random:384181-384203 ACCAAATATATATATTCATAAGG - Intergenic
1132597146 16:758092-758114 ATCACATAGACACATAGATATGG + Intronic
1133613582 16:7455447-7455469 ATTAAATATTTACATAGATATGG + Intronic
1135237742 16:20774539-20774561 TGTAAAGATACACATAGATAGGG - Intronic
1136668044 16:31831544-31831566 ACCAAATAAACATTTAGAGATGG + Intergenic
1138727726 16:59159109-59159131 AGCAAATATCCACATAAATAAGG - Intergenic
1138727887 16:59160941-59160963 AGCAAATATCCACATAAATAAGG - Intergenic
1140593678 16:76382818-76382840 ATCAAATATACAAATAAATTGGG + Intronic
1141358447 16:83371948-83371970 ACCGTATATACAGATATATAGGG + Intronic
1142174791 16:88640127-88640149 ACAATAAATACACATAAATAGGG - Exonic
1142781554 17:2185116-2185138 CACAAATACAGACATAGATACGG + Intronic
1144655366 17:17031747-17031769 CCCAAACATGCACATAGATATGG + Intergenic
1146805116 17:35858703-35858725 ATCAAATATACACAGACACATGG + Intronic
1148072931 17:44918841-44918863 ACCAAAGATACAGACAGATTTGG + Intergenic
1148943772 17:51240035-51240057 ATCAAATATAAAAAAAGATAAGG - Intronic
1150009735 17:61492717-61492739 ACTAAAAATACACATCGATTGGG - Intergenic
1150476136 17:65476826-65476848 TGCAAATATACACATACATGTGG - Intergenic
1151391870 17:73792900-73792922 CCCAGATATAGACATACATATGG + Intergenic
1152055046 17:78018083-78018105 ACCATATATATACACACATATGG - Intronic
1153154197 18:2130395-2130417 CACAAATCTACACATAGGTAAGG - Intergenic
1153518652 18:5930566-5930588 AAAAAATATACACAAATATAAGG - Intergenic
1153538077 18:6124381-6124403 ACTATATATAGACATATATAGGG + Intronic
1154454947 18:14512362-14512384 TCCTAATATACGCATAGCTAAGG - Intronic
1155245788 18:23907735-23907757 ACCTAATGCACACACAGATAGGG - Exonic
1156926113 18:42582024-42582046 AACAAATGAACAGATAGATATGG + Intergenic
1158196857 18:54897058-54897080 ACAAAATATATGCATAGGTAAGG + Intergenic
1159077435 18:63697368-63697390 ACCAAATGTAGACAAAGATATGG - Intronic
1159515806 18:69456339-69456361 ACCACATATGAACATAAATATGG - Intronic
1159872579 18:73775243-73775265 GCCAAATTCCCACATAGATATGG - Intergenic
1160164557 18:76498438-76498460 AATAAATTTACACAAAGATAGGG - Intergenic
1161132603 19:2600087-2600109 CCAAAATATATACATAAATATGG + Intronic
1165394006 19:35554165-35554187 ACTGAAGATACACAGAGATAGGG - Intronic
1165506316 19:36233008-36233030 ACAAAATAAACACATGGATACGG - Intronic
1166034613 19:40158763-40158785 ACCAAATTTACATAGAGAGAAGG + Intergenic
1166396211 19:42443234-42443256 GCCAAATATTCAGATAGAGAGGG - Intergenic
1166428942 19:42706680-42706702 ACAATATATAAACATAGGTATGG + Intronic
1166442594 19:42828009-42828031 ACAATATATAAACATAGGTATGG + Intronic
1166450396 19:42894468-42894490 ACAATATATAAACATAGGTATGG + Intronic
1167051319 19:47080473-47080495 ACCAAAGATACACAAAGACGAGG - Intronic
1168484699 19:56751076-56751098 CCCAAAAATTAACATAGATAAGG - Intergenic
1168560598 19:57379598-57379620 ACTAAATATCTACATAGATTGGG - Intronic
925527264 2:4816579-4816601 ATCTAATAGACACATAAATATGG - Intergenic
927656436 2:24950874-24950896 AACAAATACACACACAGATGAGG + Intronic
927803892 2:26127894-26127916 AGCAAATATAAACATCGAAAAGG + Exonic
928307799 2:30185202-30185224 AACATATATAAACATAGAAAAGG - Intergenic
928366630 2:30707935-30707957 ACGAAATATACAGATAAAAATGG - Intergenic
928539200 2:32268320-32268342 ACATAATATAAATATAGATATGG - Intergenic
930182788 2:48381296-48381318 ACCATATCTAAACATAGAAAAGG + Intergenic
930238760 2:48914005-48914027 ACCCAATATAAAAATAGGTAAGG - Intergenic
930277059 2:49323767-49323789 AACATATCTACACATAGAAAAGG - Intergenic
930309648 2:49723845-49723867 AACACATCTACACATAGAAAAGG + Intergenic
930416325 2:51094746-51094768 ACCAAATACAGACATACCTATGG + Intergenic
930503036 2:52247257-52247279 ACTAAATAGACAAATTGATATGG + Intergenic
930565365 2:53012286-53012308 TCCCAATATACACTTAAATATGG + Intergenic
931490589 2:62741992-62742014 AACATATATAAACATAGAAAAGG - Intronic
931933866 2:67173394-67173416 ACCAAATATATACATATATTTGG + Intergenic
932778924 2:74547954-74547976 AAGAAATATATAGATAGATAAGG + Intronic
932828244 2:74960874-74960896 AACAAATCTAAACATAGAAAAGG - Intronic
932953878 2:76328048-76328070 AACAAATCTGCTCATAGATATGG + Intergenic
933636709 2:84716138-84716160 CCCATATATATACATATATATGG + Intronic
936867973 2:117098454-117098476 ACCAAATATACTCAGAGAAAAGG - Intergenic
937315475 2:120929525-120929547 ACCAAATATACAAAGAAATGTGG - Intronic
938282695 2:130076009-130076031 TCCAAATATATGCATAGCTAAGG - Intronic
938333328 2:130464579-130464601 TCCAAATATATGCATAGCTAAGG - Intronic
938356485 2:130656092-130656114 TCCAAATATATGCATAGCTAAGG + Intronic
938432918 2:131262898-131262920 TCCAAATATATGCATAGCTAAGG + Intronic
938834928 2:135092122-135092144 ACCATATATACATATATGTAAGG + Intronic
939820290 2:146948702-146948724 ACCATAGATACTCAAAGATATGG - Intergenic
940236994 2:151522464-151522486 ACCTAACATACACATACATTAGG + Intronic
943678110 2:190736940-190736962 AACAAATCTAAACATAGAAAAGG - Intergenic
945292285 2:208138159-208138181 AACAAATCTAAACATAGAAAAGG + Intergenic
945339611 2:208636866-208636888 ATCATATACACACATATATATGG - Intronic
945872526 2:215243571-215243593 CTCAAATATTCACATAAATAAGG - Intergenic
946043034 2:216798741-216798763 CACAAATATATACATATATAAGG - Intergenic
947011031 2:225567186-225567208 AACATATATAAACATAGAGAAGG + Intronic
947014603 2:225604699-225604721 AAAAAATATACATATAAATATGG - Intronic
947250047 2:228092542-228092564 GGCACATATACACATATATATGG - Intronic
947250048 2:228092563-228092585 ATATAATATACACATATATATGG - Intronic
947250049 2:228092615-228092637 ATATAATATACACATATATATGG - Intronic
948045170 2:234937993-234938015 AGCAAATGGACACAGAGATAGGG + Intergenic
949077166 2:242067812-242067834 AGCAAATATATACAAAGGTATGG - Intergenic
1168937731 20:1681410-1681432 ACCACACACACACATAGATAAGG - Intergenic
1169723659 20:8705483-8705505 TCAAAATAAACACAAAGATACGG + Intronic
1170021760 20:11844542-11844564 ACCAAATATACACATGCTGAAGG + Intergenic
1171108417 20:22458177-22458199 ATAAAATATAGACATGGATATGG + Intergenic
1173117654 20:40261259-40261281 AGCATATATAAACATAGAAAAGG - Intergenic
1173937545 20:46880554-46880576 ACCAGATATCAAGATAGATAGGG - Intergenic
1175744351 20:61444533-61444555 CACAAAGATACACATACATACGG - Intronic
1175744353 20:61444795-61444817 CACAAAGATACACATACATACGG - Intronic
1176552497 21:8233101-8233123 ACAAAAGATACACACAGAGAGGG - Intergenic
1176571402 21:8415694-8415716 ACAAAAGATACACACAGAGAGGG - Intergenic
1176579316 21:8460256-8460278 ACAAAAGATACACACAGAGAGGG - Intergenic
1177399920 21:20589769-20589791 AACATATATAAACATAGAAAAGG - Intergenic
1177623274 21:23624813-23624835 AATATATATACACATATATATGG + Intergenic
1177654646 21:24002268-24002290 CCCAAAAACACACACAGATAAGG - Intergenic
1178731858 21:35110990-35111012 TCCATATATAAACATATATATGG - Intronic
1179436355 21:41364642-41364664 AATAAATATATACATATATATGG + Intronic
1179547306 21:42121502-42121524 AGAAAATATACACATACATGAGG + Intronic
1180476994 22:15720828-15720850 TCCAAATATATGCATAGCTAAGG + Intronic
1181963469 22:26639771-26639793 AACAATTATATACATACATAGGG + Intergenic
1183580027 22:38718953-38718975 ACCATATAGACACATAAATATGG - Intronic
1183855077 22:40626632-40626654 ACAATATATACACATATATATGG + Intronic
1184123226 22:42467604-42467626 ACCAAGTATAGGCAAAGATATGG + Intergenic
1184539988 22:45115555-45115577 ACCAGATATTCACATACAAAAGG + Intergenic
1185017745 22:48354818-48354840 ACCAATTTTACAGCTAGATATGG - Intergenic
1203257488 22_KI270733v1_random:149843-149865 ACAAAAGATACACACAGAGAGGG - Intergenic
949702661 3:6776970-6776992 TCCCAATATTTACATAGATATGG - Intronic
950205676 3:11078468-11078490 ACCAGGTAAACACATAGCTAGGG - Intergenic
951723542 3:25728224-25728246 ACCAAAAACATACAGAGATAAGG - Intronic
951843991 3:27065809-27065831 GACACATATAGACATAGATATGG - Intergenic
952681182 3:36095131-36095153 ACCACATACACAAATAGAAAAGG + Intergenic
953524074 3:43672694-43672716 ACTAAAAATACACAAAGAAATGG - Intronic
955150857 3:56365941-56365963 ACTAAATATACAAATGGACATGG + Intronic
955225108 3:57053879-57053901 ACCAAATTTACTTATATATATGG + Intronic
956419372 3:69070511-69070533 GTCAAAGATACACAGAGATAAGG - Intronic
956770816 3:72524519-72524541 ATCAAATACACATATATATAAGG + Intergenic
957619071 3:82571376-82571398 ACCACATTTACACATATATAGGG + Intergenic
957654002 3:83048120-83048142 ACCAAGTTTAGACAAAGATATGG + Intergenic
957685248 3:83496460-83496482 ATCAATTATACATATAGTTAAGG + Intergenic
957688961 3:83542580-83542602 GCCAAAAACACACATAGATAGGG - Intergenic
957689787 3:83552998-83553020 TCCAAATAAAGACAAAGATAAGG + Intergenic
957848104 3:85765827-85765849 ACAAAACAAAAACATAGATAGGG - Intronic
959241396 3:103799735-103799757 ACAAAATATACACATCCAAATGG - Intergenic
959251979 3:103960273-103960295 AACAAAAATACACATGTATAAGG + Intergenic
960369146 3:116811861-116811883 GCTAAATATACACATGGAGATGG + Intronic
960606779 3:119514291-119514313 CCCACACATATACATAGATATGG - Intronic
962529479 3:136265790-136265812 ACCAAGTATCAACAAAGATATGG - Intronic
963361440 3:144277882-144277904 ACAAAAAATACACATAGAAGCGG - Intergenic
963783266 3:149508412-149508434 AACAAACATGCACTTAGATAAGG - Intergenic
964898290 3:161624360-161624382 GGCAAATAGACACATAGAAAAGG - Intergenic
964985184 3:162729544-162729566 ACCAAATATTGGCAAAGATATGG + Intergenic
965043346 3:163540573-163540595 ACCAAATAGATATGTAGATAAGG + Intergenic
965583902 3:170298222-170298244 AACAAGTATAAACATTGATATGG - Intronic
966499107 3:180618015-180618037 AACAAATCTAAACATAGAAAAGG - Intronic
966699588 3:182832812-182832834 ACCAAATATAAAAATAATTATGG + Intronic
969201414 4:5609215-5609237 AGCAGATAGATACATAGATAGGG - Intronic
970347415 4:15166686-15166708 ACTGAATTTACACATAGACAGGG - Intergenic
971210885 4:24615272-24615294 AACAAATCTAAACATAGAAAAGG + Intergenic
971667059 4:29501070-29501092 TCAAGATATACACAAAGATAAGG - Intergenic
972160539 4:36221063-36221085 AACAAATCTAAACATAGAAAAGG - Intronic
972802791 4:42494801-42494823 ACCAAATACATACATTGATGTGG - Intronic
974217059 4:58861967-58861989 ACCAAATAATCACAATGATATGG - Intergenic
974386317 4:61204654-61204676 ACCATATACACAAATAGATCAGG - Intronic
974988430 4:69057886-69057908 GCCAAATGTACTTATAGATAGGG + Intronic
976046144 4:80950375-80950397 GGAAAATATACACATAGAAATGG + Intronic
976066321 4:81191715-81191737 AGAAAATATACACATCGAAAAGG + Intronic
976470211 4:85419558-85419580 ATCATATATAAAAATAGATAAGG - Intergenic
976691084 4:87867872-87867894 CCCAAATATATATATAGAAACGG - Intergenic
977129593 4:93218710-93218732 AACTAATACACATATAGATAAGG - Intronic
977342662 4:95778832-95778854 ACCAAATAAACAAATAAACATGG - Intergenic
977956292 4:103030731-103030753 ACTAACTATACACATAAAAATGG - Intronic
979937609 4:126717177-126717199 ACCACATATACACACCGAGATGG - Intergenic
981052128 4:140319590-140319612 TCCAAATATACACAGAAAGATGG + Intronic
981344213 4:143656596-143656618 ACCAAATAGACAAATCTATAGGG + Intronic
981374066 4:143993263-143993285 ACCAGTTATACACATAAAGAGGG + Intergenic
981801026 4:148655951-148655973 TCCATATATACACATATATAGGG - Intergenic
981986294 4:150861466-150861488 AACAAATATAAACATAGAAAAGG + Intronic
982590141 4:157298466-157298488 GAAAAATAAACACATAGATATGG + Intronic
983141907 4:164160389-164160411 AGCATATCTAAACATAGATAGGG + Intronic
983256965 4:165410633-165410655 AACAAATGTAAACACAGATATGG - Intronic
983435088 4:167703878-167703900 TGCATATATACACATATATATGG + Intergenic
983743408 4:171164497-171164519 ACAAAATATATTCATTGATAAGG - Intergenic
986800921 5:11259266-11259288 CCCACATATACACACAGAGAGGG - Intronic
987519997 5:18969324-18969346 GACATATATACACACAGATAAGG + Intergenic
987899478 5:23993034-23993056 AACAAATCCAGACATAGATAAGG + Intronic
987904875 5:24063140-24063162 ACAAATTATACTCATATATATGG - Intronic
987920145 5:24269412-24269434 GCCATATATAAACATATATATGG - Intergenic
988043235 5:25914005-25914027 AACAGATATAATCATAGATATGG - Intergenic
988399554 5:30744733-30744755 AACATATCTACACATAGAAAAGG + Intergenic
988445002 5:31275923-31275945 ACCAAAAATAAACAGACATACGG + Intronic
988681880 5:33491404-33491426 ACTAAATCTGCACTTAGATAAGG - Intergenic
989403602 5:41036154-41036176 CCCACATTTATACATAGATATGG + Intronic
989781606 5:45272237-45272259 GACACATATACACACAGATATGG - Intronic
990496079 5:56349392-56349414 AACATATATAAACATAGAAAAGG + Intergenic
990505438 5:56439497-56439519 AACATATTTACACATAGAAAAGG + Intergenic
990599430 5:57342605-57342627 ACCAAATAGACACATAGCAAAGG + Intergenic
990626604 5:57619877-57619899 ACCAAGTTTCCACATATATATGG - Intergenic
990969708 5:61490963-61490985 TCTAAATATATACATATATAGGG + Intronic
991454683 5:66789896-66789918 AACAAATACACACATATTTATGG - Intronic
992483389 5:77172988-77173010 AGCCAATAAACACATATATAGGG + Intergenic
993289745 5:86051198-86051220 ACAAAAAATACATATAGCTAAGG - Intergenic
993294801 5:86122727-86122749 AGTACATATACACATATATATGG - Intergenic
993446480 5:88018571-88018593 TCCAAATATACAGAAATATATGG - Intergenic
993840284 5:92869475-92869497 TCCATATATATATATAGATATGG + Intergenic
993845588 5:92938988-92939010 ACCATATAGAAACATAGATCAGG + Intergenic
993852495 5:93027985-93028007 AACAAATATACACACATTTACGG + Intergenic
994412566 5:99426379-99426401 TACATATATACACATATATATGG + Intergenic
994412568 5:99426431-99426453 TACATATATACACATATATATGG + Intergenic
994412569 5:99426456-99426478 TACATATATACACATATATATGG + Intergenic
994412570 5:99426481-99426503 TACATATATACACATATATATGG + Intergenic
994412571 5:99426506-99426528 TACATATATACACATATATATGG + Intergenic
994412574 5:99426585-99426607 TACATATATACACATATATATGG + Intergenic
994412575 5:99426610-99426632 TACATATATACACATATATATGG + Intergenic
994412576 5:99426635-99426657 TACATATATACACATATATATGG + Intergenic
994412577 5:99426660-99426682 TACATATATACACATATATATGG + Intergenic
994412578 5:99426685-99426707 TTCATATATACACATATATATGG + Intergenic
994412579 5:99426710-99426732 TACATATATACACATATATATGG + Intergenic
994412581 5:99426761-99426783 ACCATATATATACATATATATGG + Intergenic
994481251 5:100338799-100338821 TACATATATACACATATATATGG - Intergenic
994481252 5:100338824-100338846 TACATATATACACATATATATGG - Intergenic
994481253 5:100338849-100338871 TACATATATACACATATATATGG - Intergenic
994481254 5:100338874-100338896 TACATATATACACATACATATGG - Intergenic
994583870 5:101681475-101681497 CCCAAATATACACTCAGATGTGG + Intergenic
996808213 5:127482203-127482225 TCCATATATACATATATATATGG + Intergenic
998131058 5:139651218-139651240 ACCAGATACACACATAAATAAGG - Intronic
999829922 5:155308623-155308645 AACACATAAATACATAGATATGG + Intergenic
999894686 5:156018429-156018451 AACAAACATACACAAATATATGG + Intronic
1000556311 5:162730385-162730407 TTCAAATAAACACAAAGATATGG + Intergenic
1001713072 5:173793547-173793569 GACATATATACACATACATATGG + Intergenic
1002914820 6:1520383-1520405 ACCACATACACACACAGAGATGG - Intergenic
1003467496 6:6394854-6394876 AAGCAATATACACATAGAAATGG - Intergenic
1003711089 6:8590868-8590890 ACCATATATATATATATATATGG + Intergenic
1003711090 6:8590869-8590891 ACCATATATATATATATATATGG - Intergenic
1003757904 6:9142914-9142936 AAAAAATAGACAAATAGATATGG - Intergenic
1003789737 6:9531989-9532011 AACATCTATACATATAGATAGGG + Intergenic
1005230416 6:23695138-23695160 ACCACATATACACACACACACGG + Intergenic
1006345424 6:33477527-33477549 ACCTAAAATACACATCAATATGG + Intergenic
1008001842 6:46368656-46368678 AACATATCTACACATAGAAAAGG + Intronic
1008296149 6:49780613-49780635 AACATATATAAACATAGAAAAGG + Intergenic
1008428707 6:51389335-51389357 ACCAAGTAGACACATAGCGATGG - Intergenic
1009728658 6:67568922-67568944 AGCAAATATATCCATAAATAAGG + Intergenic
1010809826 6:80288764-80288786 AAAAAAAATACACATATATATGG - Intronic
1010917562 6:81639616-81639638 TATAAATATACACATATATATGG + Intronic
1011652203 6:89516797-89516819 AGGAGATATACAGATAGATATGG - Intronic
1012129980 6:95478023-95478045 CACATATATACACATATATATGG + Intergenic
1012225999 6:96703902-96703924 GCCAAATATACACATTGAATTGG - Intergenic
1012463146 6:99486562-99486584 ACTATATATACATATATATATGG + Intronic
1013190204 6:107796406-107796428 AGCCAATATACACATAAAAACGG - Intronic
1014248058 6:119088203-119088225 ACTAAATATACACTTAAAAATGG + Intronic
1014568795 6:122983987-122984009 TCTAATTATACACATAAATATGG + Intergenic
1014722145 6:124930166-124930188 ACCATATCTAAACATAGAAAAGG + Intergenic
1014807431 6:125845848-125845870 ACCAAATATACACATAGATATGG - Intronic
1014866560 6:126538739-126538761 TCCAAACATACAAATAGATGAGG + Intergenic
1016109144 6:140200289-140200311 ACAATATATAAAAATAGATATGG - Intergenic
1016625663 6:146164879-146164901 AGCAAATATATAAATAAATATGG - Intronic
1018407030 6:163496766-163496788 ATCAAGTTTACACATACATAAGG - Intronic
1019101723 6:169636021-169636043 TTCAAATATATACATATATATGG - Intronic
1020795244 7:12671053-12671075 TCCATATATACACATATATATGG - Intergenic
1021156145 7:17212826-17212848 AGCAAATATAAATATAAATAAGG - Intergenic
1021484630 7:21154233-21154255 CCCATATATACATATACATATGG - Intergenic
1022592680 7:31680778-31680800 ACAAAAAATACACCTGGATAGGG + Intergenic
1022905115 7:34848297-34848319 AACACATACACACATATATATGG - Intronic
1023404186 7:39814396-39814418 ACCAAATATTCACATCTATGTGG - Intergenic
1024488643 7:49949877-49949899 GCCAAGAATTCACATAGATATGG + Intronic
1024746761 7:52416364-52416386 ACCAAAAATAAATATAAATATGG + Intergenic
1025264595 7:57445642-57445664 AATATATATACACATATATAGGG + Intergenic
1025264600 7:57445796-57445818 AATATATATACACATATATAGGG + Intergenic
1027825301 7:83106663-83106685 ATAAAATATCCACATAGAAAAGG + Intronic
1027901177 7:84117146-84117168 CCCAAATATGCACATATATGTGG + Intronic
1028060770 7:86312102-86312124 TACAAATATACACACATATATGG + Intergenic
1029583294 7:101452716-101452738 AACATATCTACACATAGAAAAGG + Intronic
1029721599 7:102369442-102369464 AGCAAATATATACATATATTTGG + Intronic
1029870577 7:103687756-103687778 ACCAAATAAATAAATAAATAAGG + Intronic
1030038572 7:105429673-105429695 AACAAATATATATATATATATGG - Intergenic
1030399220 7:109027671-109027693 ACCCAATATACACATAAAGCTGG + Intergenic
1030775334 7:113527971-113527993 ACTGAATATACACATTGATCTGG - Intergenic
1030859783 7:114611057-114611079 ACTATAGATACACAAAGATACGG - Intronic
1032330357 7:130973590-130973612 ACCAAGAATACACATACATCAGG + Intergenic
1032687441 7:134249865-134249887 AACAAATTTACACAAAGATCTGG + Intronic
1032849625 7:135782942-135782964 AACAAATACACACATAATTATGG + Intergenic
1033338322 7:140472117-140472139 ACGAAATAAACACAAAGAAAGGG + Intronic
1034617065 7:152427362-152427384 ACAAAATATACACACAGTTTGGG + Intronic
1035306020 7:157932228-157932250 ACCAAAAATTCACACTGATATGG + Intronic
1035535719 8:389697-389719 AGCAAATATATACAAAGGTATGG - Intergenic
1036192689 8:6685263-6685285 TCCAACTATATACATATATATGG + Intergenic
1036424654 8:8632960-8632982 ACAAAATTTACACATTCATATGG + Intergenic
1036621768 8:10428739-10428761 ACCAAATCTAGACATACATAAGG + Exonic
1037293243 8:17373706-17373728 AGCAAGTATAAACATACATACGG + Intronic
1038065318 8:23957706-23957728 GCCATATATACACATATATATGG - Intergenic
1038507124 8:28093948-28093970 ACCAAAATTATACTTAGATATGG + Intronic
1039181570 8:34872758-34872780 GACAATTATACACATAGATCTGG - Intergenic
1039605809 8:38879524-38879546 CCCATATATATACATATATATGG + Intergenic
1040129074 8:43773254-43773276 ACCAAATATACAGATAGACACGG + Intergenic
1040404896 8:47090184-47090206 TCCAAATATATGCATAGCTAAGG - Intergenic
1041418638 8:57642446-57642468 ACCAAAAATACACAAACAGAGGG - Intergenic
1041767048 8:61429641-61429663 TCCAAACATACACATGGCTATGG - Intronic
1043185527 8:77143494-77143516 ACTAAATATACAAATAGAAATGG - Intergenic
1043375714 8:79647304-79647326 AGTAAATATACAGATAGACATGG + Intronic
1045822522 8:106357184-106357206 CACATATATACACATATATATGG - Intronic
1046211030 8:111076389-111076411 ACAAAATATAAACATATGTAAGG + Intergenic
1047056548 8:121170973-121170995 ACCAAATGTCCACAAAGATAAGG - Intergenic
1047909569 8:129513051-129513073 ACCATGTATATACATACATAGGG + Intergenic
1047943002 8:129844689-129844711 AACAAACATATACATACATATGG + Intronic
1049202591 8:141348825-141348847 AACAAATCCACACATAGAAAAGG - Intergenic
1050579355 9:7034929-7034951 AACAAATATACAAAAAGAAAGGG - Intronic
1051103972 9:13556752-13556774 ACCAAAAATGAACATAGAAATGG - Intergenic
1052037163 9:23695727-23695749 ACCATATCTAAACATAGAAAAGG + Intronic
1053238977 9:36480848-36480870 ACCAAATATATACATGGAAGGGG - Intronic
1056288209 9:85112882-85112904 ATCATATATACACGTATATATGG + Intergenic
1056317510 9:85405185-85405207 AACATATCTACACATAGAAAAGG - Intergenic
1056449648 9:86704396-86704418 AACAAATCTAAACATAGAGAAGG - Intergenic
1056664262 9:88568558-88568580 CCCAAGTATAAACATAAATATGG - Intronic
1058112778 9:101049771-101049793 AACATACATACACATATATATGG - Intronic
1058264859 9:102886435-102886457 ACTAAATTTACAAATAGATATGG + Intergenic
1058316357 9:103571145-103571167 ATAAAATATATACATATATACGG + Intergenic
1058711470 9:107682855-107682877 ATGAAATATACACATATATATGG - Intergenic
1059593184 9:115686722-115686744 AACAAAAATTCAGATAGATATGG - Intergenic
1203473677 Un_GL000220v1:131714-131736 ACAAAAGATACACACAGAGAGGG - Intergenic
1186233581 X:7483272-7483294 AACAATTGTACACATTGATATGG + Intergenic
1186419860 X:9416898-9416920 AGCAAATAAACACAGAGATGGGG - Intergenic
1186856013 X:13626747-13626769 ACAAAGCATACACAAAGATATGG - Intronic
1186999400 X:15159636-15159658 TCCAAATAGACACAGAAATATGG + Intergenic
1187903480 X:24045893-24045915 CACACATATACACATAAATATGG + Intergenic
1188215121 X:27466803-27466825 AACATATCTAAACATAGATAAGG - Intergenic
1191659471 X:63635264-63635286 TAGAAATATACACATAGAGAGGG + Exonic
1191698111 X:64010280-64010302 AACATATATAAACATAGAAAAGG + Intergenic
1192098374 X:68237345-68237367 TCCTAATATCCACATAGAAATGG - Intronic
1193317870 X:80084920-80084942 ACCATATCTAAACATAGAAAAGG - Intergenic
1193484864 X:82074892-82074914 ACAAAATATATAAATAAATATGG + Intergenic
1193681774 X:84529316-84529338 TATAGATATACACATAGATATGG - Intergenic
1194419533 X:93656431-93656453 ATGAAATATAAACATAGAAATGG + Intergenic
1194903737 X:99547408-99547430 ACTAAATATCCACATACAAAGGG + Intergenic
1198333763 X:135646537-135646559 TCCATATATACATATATATATGG - Intergenic
1198407091 X:136324402-136324424 AATAAATAAACACATAAATATGG - Intronic
1198407115 X:136324575-136324597 AATAAATAAACACATAAATAAGG - Intronic
1199891795 X:152091306-152091328 AGCATATATTCACATATATATGG - Intergenic