ID: 1014807716

View in Genome Browser
Species Human (GRCh38)
Location 6:125849170-125849192
Sequence TTGTAGTAGCTGAATGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014807716_1014807721 24 Left 1014807716 6:125849170-125849192 CCGTTTTCATTCAGCTACTACAA 0: 1
1: 0
2: 2
3: 25
4: 304
Right 1014807721 6:125849217-125849239 TGCTCACTTCTGCAGTCAGTCGG 0: 1
1: 0
2: 1
3: 25
4: 184
1014807716_1014807717 -6 Left 1014807716 6:125849170-125849192 CCGTTTTCATTCAGCTACTACAA 0: 1
1: 0
2: 2
3: 25
4: 304
Right 1014807717 6:125849187-125849209 CTACAAATGATTTCTTTAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014807716 Original CRISPR TTGTAGTAGCTGAATGAAAA CGG (reversed) Intronic
901337779 1:8466010-8466032 TTGTTTTAGCTGCATGAAAGCGG - Exonic
905089184 1:35413966-35413988 TTGTAGTACCTGTTTGAAAATGG + Exonic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
909020640 1:70427133-70427155 TTGTCTTACCTTAATGAAAATGG + Intronic
909072199 1:71008887-71008909 TTCTAGGAGCTGAATGACACAGG - Intronic
909421283 1:75469030-75469052 TTTTAGTAGCTGCATTAAAAAGG + Intronic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910009410 1:82442520-82442542 TTGTAGTTGCTGCTTCAAAAGGG + Intergenic
910377615 1:86590474-86590496 TTGGATGAGCTAAATGAAAAGGG - Intergenic
910694832 1:90000956-90000978 TTGTAGTAGTGGAGTGAACAGGG + Intronic
911603279 1:99870386-99870408 TATTAGCAGCTGAAGGAAAAAGG - Exonic
912863749 1:113238024-113238046 TTGTAATTGCTTAATTAAAAAGG + Intergenic
914463146 1:147903211-147903233 TTGTAGAATTTGAGTGAAAAGGG - Intergenic
914764023 1:150622430-150622452 GTGGAGTAGCCTAATGAAAAGGG - Intronic
915211029 1:154309482-154309504 TTTTACTAGCAGCATGAAAATGG + Intergenic
915745741 1:158156035-158156057 TTCTAGTAGCTATATTAAAAAGG + Intergenic
918168896 1:181976329-181976351 TTGGAGTACCTGAAGGAAAGGGG + Intergenic
918196185 1:182224190-182224212 TTGTATAAGCTGTAAGAAAAGGG - Intergenic
918399310 1:184147557-184147579 TTGTAGTGCCTGAAGGGAAAGGG + Intergenic
919447223 1:197722250-197722272 TTGTATTTTCTGAATGAGAAAGG + Intronic
923163007 1:231333896-231333918 TTCTTTTATCTGAATGAAAATGG - Exonic
923662572 1:235971293-235971315 TTTTATTAGCTGGATGGAAATGG - Intergenic
924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG + Intronic
1064066280 10:12184711-12184733 TTATAGTTGCTGAATAAAATTGG - Intronic
1064403266 10:15038735-15038757 TTTTATTAGCAGCATGAAAACGG + Intronic
1065173586 10:23055353-23055375 TTGTTGTATCTGAATGAGACTGG - Intergenic
1065197986 10:23285454-23285476 TTATAGTAGCTGTGTTAAAAAGG + Intronic
1065586403 10:27222336-27222358 TTGTAGGAGTTGAATAAAATGGG - Intronic
1067540476 10:47147439-47147461 TTTTACTAGCTGAATGACATTGG + Intergenic
1069133658 10:64736899-64736921 TTTTATTAGCAGCATGAAAACGG + Intergenic
1070375237 10:75824242-75824264 TTCTAGTAGCTACATTAAAAAGG - Intronic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1073170197 10:101499855-101499877 TTGTAATAACTAAATGAATATGG - Intronic
1073549336 10:104382881-104382903 TTTTTGTAGCAGTATGAAAATGG + Intronic
1074045760 10:109837591-109837613 TAGTAGTAGGTGCATGAAAGTGG + Intergenic
1076400330 10:130179336-130179358 TTTTAGGAACTGAAAGAAAATGG + Exonic
1076474153 10:130740786-130740808 TTGTAGCAGCTGAATTTAAAAGG - Intergenic
1077836512 11:5931512-5931534 TTGTAGAAGCCGAATAATAATGG - Intronic
1078585339 11:12581674-12581696 TTAGAATAGCTGAATGAGAAAGG + Intergenic
1078865897 11:15296946-15296968 TTCCACTATCTGAATGAAAAGGG + Intergenic
1080341339 11:31268946-31268968 ATGTTTTAGCTCAATGAAAAGGG - Intronic
1082186314 11:49186010-49186032 TTATAGTAGCAAAAAGAAAAGGG - Intronic
1082775099 11:57238447-57238469 ATGTAGGAGGTGAGTGAAAAGGG + Intergenic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1083104466 11:60344781-60344803 ATGAAGTAGCTGAAGGAAATAGG - Intronic
1084458327 11:69281936-69281958 GTGTGGTAGCTGACTCAAAATGG + Intergenic
1086680020 11:89659361-89659383 TTATAGTAGCAAAAAGAAAAGGG + Intergenic
1086931047 11:92693525-92693547 TTGTTGTAGCTGAATGCATTTGG - Intronic
1087033552 11:93731517-93731539 CTGAAGGGGCTGAATGAAAATGG - Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088149967 11:106732917-106732939 TTGTAGCAGATGAATGAGACAGG - Intronic
1088443073 11:109893302-109893324 TTGTAGTAGCTATTTGAGAAAGG + Intergenic
1088803497 11:113329467-113329489 TTTTATTGGCTGAATGCAAATGG - Intronic
1089780755 11:120871730-120871752 TGGTAGTGGCTGAATAAAAGTGG + Intronic
1090738776 11:129637326-129637348 TTGTTGTAACTAAAGGAAAATGG - Intergenic
1091505028 12:1059084-1059106 TTGTTGTAGCTTATTGTAAATGG + Intronic
1091885372 12:4013396-4013418 TTGGAGTAGCTGCATGGAGATGG - Intergenic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1093673857 12:21910709-21910731 TTGTAATACCAAAATGAAAATGG + Intronic
1093966746 12:25335796-25335818 TCTTAGTAGATGAATGTAAAAGG + Intergenic
1095508005 12:42918811-42918833 TTGTGGTAGCTAAATCTAAAAGG + Intergenic
1097448947 12:59712591-59712613 CAGTAGTTTCTGAATGAAAACGG - Intronic
1098064609 12:66600677-66600699 TTCTATAATCTGAATGAAAATGG - Intronic
1098305622 12:69099704-69099726 TTTTAGTAGCTGAAAAACAACGG - Intergenic
1098403322 12:70097267-70097289 TTGAAATAACTGAATGAGAAGGG - Intergenic
1098495824 12:71134917-71134939 GTGTAACAGCTGGATGAAAAAGG + Intronic
1098814679 12:75143440-75143462 GTGTGGCAGCTGAATGAAAGAGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099481894 12:83177707-83177729 TTGTAGTGGCTGAATAAATGAGG + Intergenic
1099540015 12:83896045-83896067 TTGTTATAGCAGAGTGAAAATGG + Intergenic
1100473298 12:94913141-94913163 TTGCAGTAGCTTAAGGAAAATGG - Intronic
1104178880 12:126358478-126358500 TTGGAGAAGCTGCCTGAAAATGG - Intergenic
1104432056 12:128724524-128724546 TGGAAGAAGCTGAATGAAAGAGG - Intergenic
1106071136 13:26412253-26412275 TAGCAGTAGCTGAAGGAAAAGGG - Intergenic
1106767041 13:32923518-32923540 TTGAAGTAGGAGAAAGAAAATGG + Intergenic
1107232779 13:38130334-38130356 TTTTATTAGCAGAGTGAAAACGG + Intergenic
1107243638 13:38266476-38266498 TTGAAGTACCTGAAAGAAATGGG + Intergenic
1109319907 13:60797839-60797861 TTGTAGCAGCTGAAGAAATATGG + Intergenic
1109492940 13:63127146-63127168 TTGTAGAAGCACAATGACAATGG - Intergenic
1110212264 13:72987595-72987617 TCTTAGTAGCTAAATGAACATGG + Intronic
1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG + Intergenic
1111188110 13:84770335-84770357 TTTTAATAGCTAAATGAAGATGG - Intergenic
1111213827 13:85117206-85117228 TAATTGTGGCTGAATGAAAATGG - Intergenic
1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG + Intergenic
1112842995 13:103602586-103602608 TTGTGGAAGGTGGATGAAAATGG + Intergenic
1112856797 13:103781673-103781695 TTGGAGTTGCAGAATAAAAATGG + Intergenic
1114720697 14:24878651-24878673 TTGTAGTGGTGGACTGAAAAAGG - Intronic
1115465037 14:33706059-33706081 TTGTCATACTTGAATGAAAAGGG - Intronic
1116133676 14:40892462-40892484 TTTTATTAGCAGCATGAAAATGG - Intergenic
1116268031 14:42721000-42721022 TTTTATTAACTGAAAGAAAATGG + Intergenic
1117646039 14:57853896-57853918 TTGAACTAGCTGAAGCAAAATGG - Intronic
1118142416 14:63098768-63098790 TTGTATTAACAGAATAAAAAGGG + Intronic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120168272 14:81222760-81222782 TTGTAGTTACTGGATTAAAATGG + Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120591697 14:86382083-86382105 ATACAGTAGCTGAATGGAAATGG - Intergenic
1121312887 14:92944652-92944674 TTTGAGTGGCAGAATGAAAAGGG - Intronic
1121536372 14:94693890-94693912 TTTTATTAGCAGCATGAAAATGG + Intergenic
1121809690 14:96872808-96872830 TAGTAGTAACTAAAAGAAAAAGG - Intronic
1122515277 14:102304024-102304046 TTGTAGTGCATTAATGAAAAAGG + Intronic
1122663209 14:103311586-103311608 TAGTATTTGCTGAATGAAACTGG - Intergenic
1123784682 15:23658715-23658737 TTGTATTTGGTGAATGATAAGGG - Intergenic
1124871558 15:33548428-33548450 TTGCAGTAGCTGACTATAAAAGG + Intronic
1125145025 15:36457084-36457106 TTCAAGTAGGTGTATGAAAAAGG - Intergenic
1125276264 15:37995333-37995355 TTTTGGAATCTGAATGAAAAGGG - Intergenic
1131682163 15:94735336-94735358 TTGTAGGAGGAGAATCAAAATGG - Intergenic
1131962306 15:97802601-97802623 TTGTACCAGCTGAATAAACATGG - Intergenic
1133195844 16:4169624-4169646 TCATAGGAGCTGAAAGAAAATGG - Intergenic
1135828653 16:25753854-25753876 TTGTAGGTGCTGAATAAATACGG - Intronic
1136739183 16:32498512-32498534 TCCAAGCAGCTGAATGAAAAGGG - Intergenic
1139487406 16:67265735-67265757 TTGTATGAGCTGAATGTTAATGG + Intronic
1139674544 16:68514349-68514371 TTGGAATAGATGGATGAAAATGG - Intergenic
1140785667 16:78339585-78339607 TTGTAGTAGCTTTCTGAAAAAGG + Intronic
1203014030 16_KI270728v1_random:333280-333302 TCCCAGCAGCTGAATGAAAAGGG + Intergenic
1203032365 16_KI270728v1_random:606439-606461 TCCCAGCAGCTGAATGAAAAGGG + Intergenic
1143182472 17:4992125-4992147 TTATTGAAGCTGACTGAAAAGGG + Intronic
1144356389 17:14450748-14450770 TTCTGGTGGCTGAATGAAAAAGG + Intergenic
1145860950 17:28209462-28209484 TTTTAATAGCTGAATGAACTGGG - Intergenic
1146901110 17:36589375-36589397 TTGTAGTGGCTGGTTGACAACGG + Exonic
1147441885 17:40452614-40452636 TGGTGGGAGCTGAATGGAAAGGG + Intronic
1148057322 17:44808177-44808199 TTATAGTAACTTAATTAAAAGGG + Intronic
1148514089 17:48199865-48199887 TTATAGTACCTGGATTAAAATGG + Intronic
1150450976 17:65268479-65268501 TGGTGGTGGCTGAATGGAAAGGG - Intergenic
1153847377 18:9062201-9062223 TACTAGTTGCTGAAGGAAAACGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1156934921 18:42691984-42692006 GTGTAGTAGAAGATTGAAAAAGG + Intergenic
1157274259 18:46298994-46299016 TTGTAATAGGGGCATGAAAAAGG - Intergenic
1159064833 18:63558338-63558360 GTGTAGTACCTGCATGATAACGG - Exonic
1159192114 18:65059883-65059905 GTGTAATAACTGAAAGAAAAGGG - Intergenic
1159199312 18:65163308-65163330 TTGTAGTAGCTGAACTACTACGG + Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1159646304 18:70922198-70922220 TTGCAGTATCTGAAAGAAATGGG + Intergenic
1162597882 19:11642970-11642992 CTTTATTAGCTGAATGAGAACGG + Intergenic
1163914838 19:20231979-20232001 TGGTAGCAGCTGTGTGAAAAGGG + Intergenic
1163933442 19:20420922-20420944 TAGTAGCAGCTGCAAGAAAAGGG + Intergenic
1163959145 19:20671042-20671064 TGGTGGTAGCTGCAAGAAAAGGG - Intronic
1164267721 19:23636206-23636228 TTCTTCTAACTGAATGAAAAAGG + Intronic
1164710903 19:30356630-30356652 TTGTAGCTGCTGAATGAGATCGG + Intronic
1165120502 19:33555721-33555743 TTTTAATAGCAGCATGAAAACGG - Intergenic
1168135930 19:54351962-54351984 TTGTAGTAGGGGAAAGAAAATGG - Exonic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926516509 2:13853128-13853150 CTTTATTAGCTGCATGAAAATGG - Intergenic
926540017 2:14164393-14164415 TTGGACTCGCTGAATGAAACTGG - Intergenic
926824583 2:16891256-16891278 TCTTTGTAGCTGTATGAAAATGG + Intergenic
926961568 2:18363748-18363770 TAGAAGAAGCTGAATGAAAGGGG + Intergenic
928422403 2:31148836-31148858 TTATAGAAACTGAATGGAAATGG + Intronic
928951886 2:36820549-36820571 TTGTAGTAGCTCAGGCAAAAAGG + Intergenic
930744282 2:54865185-54865207 TGCTAGTAGAAGAATGAAAAGGG + Intronic
931389613 2:61830153-61830175 TTTTAGTAGGGGAATGAAAATGG + Intronic
935866245 2:107390739-107390761 TTGTTGTAACTGAAGAAAAAGGG - Intergenic
937965381 2:127503931-127503953 TAGTAGTAACTGAACTAAAAAGG + Intronic
939445827 2:142309515-142309537 TTGTTATAGCAGTATGAAAATGG - Intergenic
939477610 2:142706755-142706777 TGGTAGGAGCTGGATGAACAAGG - Intergenic
939842176 2:147202577-147202599 TGAAAGTAGCTGAAAGAAAAGGG + Intergenic
940610637 2:155986985-155987007 TTTTAGGAGCTGAATAAAACTGG - Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
942481714 2:176395165-176395187 TTGGAGTAGTTGAAGGATAAGGG - Intergenic
942505348 2:176636849-176636871 TTATATTAGCTATATGAAAAGGG - Intergenic
942592792 2:177563620-177563642 TTGTTTTAGCTTTATGAAAAGGG + Intergenic
944005495 2:194899740-194899762 TTTTAGTAGATGAATAAAATTGG + Intergenic
944045439 2:195405752-195405774 TTGTAATATCTTAATGAAATAGG - Intergenic
944929796 2:204505555-204505577 TTCTTGCAGCTAAATGAAAAAGG - Intergenic
945021138 2:205572865-205572887 TTTTATTAGCAGCATGAAAATGG - Intronic
946209769 2:218138080-218138102 TTGTTGTTGCTGAATGCAATAGG - Intergenic
947235725 2:227938760-227938782 TGGTAGGACCTGATTGAAAAGGG - Intergenic
948508404 2:238446907-238446929 TTCTAGTATCTCAATGAAAAGGG + Exonic
1168803112 20:656335-656357 GTGAATTAGCTTAATGAAAATGG + Intronic
1171814000 20:29767287-29767309 CTGTAGAAGCTGAATGGATAAGG - Intergenic
1172822004 20:37744730-37744752 TTGTAGTAGAATAATGATAAGGG + Intronic
1173876743 20:46377356-46377378 TTTTAGTAGCAGCATGAAAAAGG - Intronic
1177133180 21:17282027-17282049 TTTTATTAGCAGAATGAAAATGG + Intergenic
1177550874 21:22620774-22620796 TTGTAATATCTGAATGTAACTGG + Intergenic
1178105504 21:29314750-29314772 TTGAAAAGGCTGAATGAAAATGG - Intronic
1178994075 21:37381451-37381473 TTGTAGTAGTTTACTGAAATGGG + Intronic
1182213551 22:28696971-28696993 GTGTAGTACCTTCATGAAAACGG - Exonic
1183719493 22:39554281-39554303 TTGTAGTGGCTGGATAGAAAGGG - Intergenic
1184641522 22:45874766-45874788 TAGTATAACCTGAATGAAAATGG + Intergenic
950179725 3:10902679-10902701 TTGCAGGAGCTTAATGAAAAGGG - Intronic
951276916 3:20698841-20698863 TTTCAGTAGCTGCATTAAAAAGG - Intergenic
952255280 3:31689857-31689879 TTTTATTAGCAGCATGAAAATGG + Intronic
952607825 3:35171572-35171594 TTGGAGTACCTGAAAGAAATGGG - Intergenic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
956365511 3:68497750-68497772 TTGCAGTAGCGGAATGACACAGG + Intronic
956956402 3:74346305-74346327 TTTTAGTATTTGAATGTAAAAGG + Intronic
957822220 3:85391824-85391846 TTGGATTAGCTGAATCAACACGG + Intronic
958538940 3:95444265-95444287 TTGTAGTTCCTGAATGATAAAGG - Intergenic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
959142275 3:102500632-102500654 TTGCAGTTGCTGAATGACAATGG - Intergenic
959501289 3:107108413-107108435 CTTTATTAGCTGCATGAAAATGG + Intergenic
959603344 3:108214119-108214141 TTATGGAAGCGGAATGAAAAAGG - Intronic
960316292 3:116181723-116181745 GTGTGGTATCTGAATGATAATGG - Intronic
961487266 3:127225769-127225791 TCCTAGAAGCTGAAAGAAAATGG + Intergenic
962176541 3:133161159-133161181 TTGGTGTGGCTGAATCAAAAGGG - Intronic
962503738 3:136024287-136024309 TTAAAGTAGCTGAATAAAACTGG - Intronic
964048752 3:152364927-152364949 TACTAGCAGCTGCATGAAAATGG + Intronic
965024943 3:163290696-163290718 TTTTTATAGCTGTATGAAAATGG - Intergenic
965270106 3:166604288-166604310 TTGTATTAGGTGAATAAAAGAGG + Intergenic
965949221 3:174284265-174284287 CTCTAGTTTCTGAATGAAAAAGG + Exonic
966652204 3:182314249-182314271 TTGGAGTACCTGAAAGAGAAGGG - Intergenic
967467938 3:189828855-189828877 TAATAGTAGCTTAAAGAAAACGG + Intronic
967815715 3:193796599-193796621 TTAAAGTAGCTGGATGAATATGG + Intergenic
968413625 4:409362-409384 TTGTAGTAGCTGGCTCACAAGGG + Intergenic
970506077 4:16731857-16731879 TTGTAGTTACTGCTTGAAAAGGG - Intronic
970563231 4:17303833-17303855 TTGCTGTAGCTGAAGGCAAAAGG - Intergenic
971746298 4:30585857-30585879 TTGGAGTAGCTGAAAGAGATGGG - Intergenic
971838814 4:31804673-31804695 TTGTCATAGCTAATTGAAAAAGG - Intergenic
971977937 4:33714819-33714841 GTACATTAGCTGAATGAAAAAGG - Intergenic
972661491 4:41120962-41120984 TTCTTGTACCTGAAAGAAAATGG + Intronic
972886359 4:43494466-43494488 TTTTATTAGGTGAATGAATATGG - Intergenic
973017883 4:45164580-45164602 TGGGAGGATCTGAATGAAAAGGG - Intergenic
974110782 4:57523162-57523184 TTTTATTAGCAGCATGAAAATGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974808335 4:66912262-66912284 TTCTAGCAGATGAATGAAAATGG + Intergenic
975782638 4:77855920-77855942 TTCTAGTAGCTATATTAAAATGG - Intergenic
977158561 4:93605571-93605593 TAGTAATAGTTGAATGAATAGGG + Intronic
977407686 4:96620829-96620851 TGGGAGTAGATGAATGCAAAGGG - Intergenic
978076022 4:104530617-104530639 TTGATGTATCTCAATGAAAATGG + Intergenic
978284071 4:107053854-107053876 TTGAAGTAGCTTAAGTAAAAAGG - Intronic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
978979708 4:114928492-114928514 TTGGAGTAAGTGAAAGAAAATGG - Intronic
979284902 4:118911800-118911822 GGGGAGTTGCTGAATGAAAATGG - Intronic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
981717772 4:147768652-147768674 TTGTAGAAGCTGAATAAATTTGG + Intronic
983313135 4:166092024-166092046 CTGTCTTAACTGAATGAAAAGGG - Intronic
984326981 4:178267819-178267841 CTGTATTAGCAGCATGAAAATGG - Intergenic
984910397 4:184668964-184668986 TGATAGGAGCTGAATGAAAAGGG - Intronic
986771143 5:10974990-10975012 TAGTGGTAGCTGAATGAATGAGG + Intronic
988010600 5:25477250-25477272 TGGAACTAGCTGCATGAAAATGG + Intergenic
988013988 5:25529657-25529679 TTTTATTAGCAGCATGAAAATGG + Intergenic
988895850 5:35674049-35674071 TTTTAGTAGATGAATGTTAAGGG + Intronic
989994374 5:50810903-50810925 TTGTAGTTGCTGTGTTAAAAAGG + Intronic
990077723 5:51872279-51872301 CTGTATTAGCAGCATGAAAATGG + Intergenic
990370697 5:55115112-55115134 CTGAAGCAGCTTAATGAAAAAGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994880107 5:105480349-105480371 TTATAGTAACTGAATCAATATGG + Intergenic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
996138647 5:119876856-119876878 TTGGAGCAGCTGAATCTAAATGG + Intergenic
996195610 5:120603049-120603071 TTTTAGTATCAGAATGATAATGG + Intronic
996281379 5:121733155-121733177 TTGTAATATCTGGATGAACATGG - Intergenic
998921674 5:147075018-147075040 TTGCAGTATCAGAAAGAAAATGG + Intronic
999119016 5:149194163-149194185 TTGTAATAAATGACTGAAAAAGG + Intronic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1002600305 5:180350601-180350623 CACTAGTGGCTGAATGAAAAAGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003153313 6:3571048-3571070 CTGTAGTAGATGAATGACAGAGG + Intergenic
1004043093 6:12001633-12001655 TTATGGTAGATGATTGAAAATGG - Intergenic
1004940497 6:20551344-20551366 TTTTAGTTACTGAAGGAAAAAGG - Intronic
1007154465 6:39729005-39729027 TTCTAGTTGCTGAATGAAATGGG - Intergenic
1007489930 6:42212280-42212302 TAATGGTAGCTGAATGACAACGG + Intronic
1008031798 6:46704847-46704869 CTTTAGCAGCTGAATGCAAACGG + Intronic
1009392277 6:63158232-63158254 TTTTTATAGCTGTATGAAAATGG + Intergenic
1009673980 6:66793021-66793043 TTATACTACCAGAATGAAAAAGG + Intergenic
1011719773 6:90143498-90143520 TGGTAGGAGCAGTATGAAAAAGG + Intronic
1012712376 6:102623922-102623944 TTGTAGTAGGTAAAGCAAAAAGG + Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015447983 6:133330116-133330138 TTGTAGCAGCTGACTAAAAGTGG + Intronic
1016280379 6:142410841-142410863 TGGTAGTAACTGATTGTAAATGG - Intronic
1017301474 6:152864934-152864956 TTCTAGTAGCTACATTAAAAAGG + Intergenic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1021066754 7:16185074-16185096 TTTTATCAGCAGAATGAAAATGG - Intronic
1021360195 7:19703503-19703525 TTGTAGTAGGTAGATTAAAAGGG + Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1022205043 7:28155651-28155673 TTGTAGTTGCTGAATGGGCATGG - Intronic
1023650636 7:42365258-42365280 CTTTATTAGCAGAATGAAAAGGG - Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1024739112 7:52336330-52336352 TTGTAGCAGGTGAGTGATAATGG + Intergenic
1024771843 7:52732324-52732346 TTGTATTAGCAGCATGAGAATGG + Intergenic
1024922135 7:54569376-54569398 TTTTAGTCGCCGAAAGAAAAGGG - Exonic
1025550769 7:62245465-62245487 TCCAAGCAGCTGAATGAAAAGGG - Intergenic
1027357344 7:77370880-77370902 TTGTAGTAGCTGAAGGCACAGGG - Intronic
1027641526 7:80739542-80739564 TTGAAGTACTTGAATGACAAAGG + Intergenic
1028082509 7:86596189-86596211 ATGTGTTAGCTAAATGAAAATGG + Intergenic
1028298869 7:89171246-89171268 TTGTAGTAACTCAATGAAGTAGG + Intronic
1028833137 7:95346991-95347013 TTGGAGTTGGAGAATGAAAAAGG + Intergenic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1031011686 7:116530688-116530710 TTGTAGTAGCTCAATCAGACTGG + Intronic
1031343144 7:120629916-120629938 TTTTAGCATCTAAATGAAAATGG + Intronic
1032204990 7:129855721-129855743 TTTTAGAAGCTTATTGAAAACGG + Intronic
1032589519 7:133178582-133178604 TTATAGTAGCTTCCTGAAAATGG - Intergenic
1033579263 7:142716703-142716725 TTGTGGTAGTTGAAGGATAAGGG - Intergenic
1033907794 7:146226988-146227010 TTATACTAAATGAATGAAAAAGG + Intronic
1033954897 7:146834764-146834786 TTGTAGCAGCTCAAAGAAAGTGG - Intronic
1036483929 8:9162850-9162872 TTTTATCAGCAGAATGAAAACGG - Intronic
1038641321 8:29331367-29331389 TTGTAATAGAAGAATGCAAAAGG - Intergenic
1038724355 8:30067175-30067197 TTCTAGTAGCTGATTGAGCAGGG - Intronic
1040052570 8:43031514-43031536 TGGTAGTAGCAGAATGGAAGTGG + Intronic
1042388781 8:68208573-68208595 TTTTAATAGCTGAATAAAATGGG + Intronic
1042710742 8:71714149-71714171 TTTTATTAGCAGTATGAAAATGG + Intergenic
1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG + Intronic
1042972311 8:74423561-74423583 TTGTATTAGGTTTATGAAAATGG - Intronic
1043563152 8:81518727-81518749 TTGTATTTGGTGAAAGAAAAGGG + Intergenic
1043696608 8:83227251-83227273 TTGAACTAGCTGGAAGAAAATGG - Intergenic
1046509194 8:115178027-115178049 TTTTAGTAGCAGACTGAACATGG + Intergenic
1046631044 8:116623425-116623447 TTGTAGTAGCTGAAGGCAGGAGG - Intergenic
1047356437 8:124126631-124126653 TTGTACTAGCACAAAGAAAATGG + Intergenic
1050029359 9:1368902-1368924 TTGTAAGATCTCAATGAAAATGG + Intergenic
1051671705 9:19517078-19517100 TTTTAAAAGGTGAATGAAAAGGG - Intronic
1051676903 9:19567597-19567619 TTGTAGTTGCTGTGTTAAAAAGG - Intronic
1052224328 9:26066605-26066627 TTGTATGAGCAGAATGCAAATGG - Intergenic
1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG + Intergenic
1052858299 9:33420910-33420932 TTGTAGATGTTGAATGAAAGAGG - Intergenic
1055223733 9:73969133-73969155 TTTTTGTAGCTGTATGAGAATGG + Intergenic
1056487577 9:87074611-87074633 TTGCAATAGTTGAATGTAAAGGG + Intergenic
1057980836 9:99661395-99661417 TCATACTAGCTGTATGAAAAAGG + Intergenic
1185973647 X:4693843-4693865 TTTTATTAGCAGCATGAAAATGG - Intergenic
1186158408 X:6750295-6750317 TACTAGGTGCTGAATGAAAATGG - Intergenic
1187693512 X:21895221-21895243 TTTTATTAGCAGCATGAAAATGG + Intergenic
1187746552 X:22415414-22415436 TTTAAGTAGATGAATGATAATGG + Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1188941783 X:36246783-36246805 TTGGAGTGGCTGAGAGAAAAGGG + Intronic
1189838467 X:45044400-45044422 TTTCAGTAACAGAATGAAAAGGG - Intronic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1192009691 X:67255348-67255370 TTGTAATAGCTGTAAGAAAGGGG - Intergenic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1192866475 X:75138596-75138618 TTGTAAAAGATGTATGAAAAAGG - Intronic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1195757778 X:108216269-108216291 TGGTATCAGCTGGATGAAAAGGG - Intronic
1196557639 X:117108368-117108390 TTATACTAGCAGAAGGAAAAGGG - Intergenic
1197388974 X:125837498-125837520 TTTTAGTACTTGAATGAAAATGG - Intergenic
1198949279 X:142051808-142051830 TTATATTAGCTTTATGAAAAGGG - Intergenic
1199386299 X:147226955-147226977 GTTTAGTAGATGAATGAGAATGG - Intergenic
1199780313 X:151052224-151052246 TTGGAGTGCCAGAATGAAAAGGG + Intergenic
1200681137 Y:6212770-6212792 TTTTTATAGCTGTATGAAAATGG + Intergenic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic