ID: 1014810821

View in Genome Browser
Species Human (GRCh38)
Location 6:125883677-125883699
Sequence TAGGGGAAAGAGAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 1, 1: 0, 2: 11, 3: 114, 4: 1081}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014810821 Original CRISPR TAGGGGAAAGAGAAGGATGG GGG (reversed) Intronic
900701292 1:4049993-4050015 TAGGGGAGAGAGGGAGATGGGGG + Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900859543 1:5218242-5218264 AAAGGGGAAGAGAGGGATGGTGG - Intergenic
901724297 1:11228631-11228653 GAGGAGAAAGAGAAGGATTGGGG + Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
902752263 1:18525186-18525208 TCATGGAAAGATAAGGATGGAGG + Intergenic
903321761 1:22547584-22547606 GAGGGGGAAGAGACAGATGGAGG - Intergenic
903788161 1:25875108-25875130 TTGGAGAAAATGAAGGATGGAGG - Intergenic
904334628 1:29788748-29788770 CAGGGGATAGGAAAGGATGGAGG - Intergenic
904338825 1:29819165-29819187 GAGGGGAAAGAGAAAGGGGGTGG - Intergenic
904512114 1:31020055-31020077 AAAGGGAAAGGGAAGGAGGGAGG - Intronic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904718135 1:32484738-32484760 CAGGGGGAAGAGAAAGAAGGGGG - Intronic
905402534 1:37714172-37714194 TAGGGCAAGGGGTAGGATGGTGG - Intronic
905619601 1:39431977-39431999 GAGGGGGCAGGGAAGGATGGAGG + Intronic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
905781853 1:40718411-40718433 TATGGAAAAGAGAAGGTAGGAGG - Intronic
906507693 1:46392654-46392676 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
906807920 1:48797367-48797389 TGGGAGAAAGGGTAGGATGGGGG - Intronic
907212562 1:52836092-52836114 TAGGGGAAAGGGAAGAATAAAGG - Intergenic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907544144 1:55244740-55244762 CAGGGGAAAGAGAAAGAATGTGG + Intergenic
907791074 1:57664121-57664143 TGGGGGAAAAAAAAGGATGTTGG + Intronic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908908729 1:69047483-69047505 AAGGGGACAGAGTAGGAAGGTGG - Intergenic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909164518 1:72202253-72202275 GAGGGGAAAGATAGGTATGGAGG - Intronic
909790687 1:79674293-79674315 TAGGGGAAAGGGTGGGAGGGGGG - Intergenic
910370016 1:86505580-86505602 AAGGGGAAAGAGAACGCTGTTGG - Intergenic
911556523 1:99351978-99352000 TGGGGGAAAAAGAAAGATAGGGG - Intergenic
911728274 1:101265311-101265333 TTGGGGAAAGAGACGAATGATGG - Intergenic
912102948 1:106234158-106234180 GAGGGGAAGTAGAAGGTTGGAGG + Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912242505 1:107926373-107926395 TAGGGGGTAGAGCAAGATGGTGG + Intronic
912372691 1:109186094-109186116 TAGGAGAGAGAGAATGAAGGAGG + Intronic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913706769 1:121433645-121433667 GAAGGGGAAGTGAAGGATGGGGG - Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914388804 1:147199187-147199209 TAGGGAACAGACAAGGAAGGAGG + Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914916639 1:151823099-151823121 ACGGGGAAAGAGAAGGGTGCTGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915239058 1:154506947-154506969 TGGGAGAAAGAGAAGGCTGGGGG - Intronic
915354292 1:155246704-155246726 TAGGGGAAGGAGTCTGATGGGGG + Intergenic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916123994 1:161553059-161553081 GAGGGGAGAGAGATGGAAGGTGG + Intergenic
916133878 1:161634421-161634443 GAGGGGAGAGAGATGGAAGGTGG + Intronic
916616690 1:166448969-166448991 GAGAGGAGAGCGAAGGATGGAGG - Intergenic
916875734 1:168966583-168966605 GAGGGGAGAGAGAGGGACGGGGG + Intergenic
917020351 1:170579883-170579905 GTGGGGAAAGAGTGGGATGGAGG - Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917397392 1:174608561-174608583 TAGGGGAAAATGTGGGATGGAGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918846387 1:189620235-189620257 AAGGAGAAAGAGAAGAAAGGTGG + Intergenic
919469480 1:197960516-197960538 TAGGAGAAAGAGTAGAATGATGG - Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
919886118 1:201936160-201936182 TGGGGGAAAGAGAAGAGTCGGGG - Intronic
920220033 1:204390257-204390279 TGGGGGATAGAGAAGAATAGTGG - Intergenic
920284383 1:204869026-204869048 TAAGGGAATGGGAAGGATAGAGG - Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920743453 1:208603060-208603082 TATGGGAAGGAGAAGCATGTTGG - Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921315763 1:213888596-213888618 GAGGGGAGAGAGAAGGTGGGAGG + Intergenic
921534618 1:216330611-216330633 TGGGGGAGAGGGGAGGATGGAGG + Intronic
921736659 1:218635746-218635768 GAGGGGAGAGAGAAGGAGCGGGG + Intergenic
921835026 1:219769721-219769743 TGGGGGAAAGAGTGGGAGGGGGG + Intronic
922128067 1:222748839-222748861 CAGGGGTAAGAGAAGGCTGTCGG + Intronic
922171463 1:223159184-223159206 GAGGGGCAAGGGAAGGAGGGAGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922192878 1:223334839-223334861 TCGGGGAAAGGGTAGGAAGGGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922824926 1:228511416-228511438 GAAGGGAAAGAGAGAGATGGGGG - Intergenic
922852206 1:228742542-228742564 TAGGAGAAAATGAAGGAAGGAGG + Intronic
923263886 1:232293982-232294004 TAGGGGAAAGGCAGGGAGGGGGG - Intergenic
923509794 1:234640625-234640647 AGGGGGAGAGAGAAGGAGGGAGG + Intergenic
923790480 1:237107059-237107081 TGGGGGAAATAAAAGGCTGGAGG + Intronic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923930538 1:238690269-238690291 TAGGGGAAAAAGAAGGTTAAGGG - Intergenic
924261011 1:242231435-242231457 TAAGGTAAAGAGAACGATGTTGG - Intronic
924309370 1:242724188-242724210 TGGGGGACAGAGAAGGAAGAAGG - Intergenic
924481171 1:244435634-244435656 GAGGAGGAAGAGAAGGATGGAGG - Intronic
924481175 1:244435653-244435675 GAGGAGGAAGAGGAGGATGGAGG - Intronic
924494697 1:244575738-244575760 TAGGGGAAAGGGAAGGAGAGGGG - Intronic
924497201 1:244601998-244602020 AAGGGGAAGGGGAAGGAAGGAGG + Intronic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063236232 10:4119293-4119315 TAGGAGGAAGCGATGGATGGGGG - Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063614812 10:7592509-7592531 TAGGGGAAAGAGGAAAATAGAGG + Intronic
1063986135 10:11504891-11504913 GAGTGGTAAAAGAAGGATGGTGG + Intronic
1064450107 10:15434515-15434537 TATGGAGGAGAGAAGGATGGGGG - Intergenic
1064457864 10:15505267-15505289 AAGGGGAAAGTGAAGGATTGGGG + Intergenic
1064521423 10:16206935-16206957 TAGGGGGAAGAGTGGGAGGGGGG - Intergenic
1064624280 10:17246482-17246504 AAGGAGAGAGGGAAGGATGGAGG + Intergenic
1064991856 10:21263383-21263405 TAGGGGAAAGGGAAAGGGGGCGG + Intergenic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065276554 10:24092063-24092085 TAAGGGAAAGAGAAGGACGTTGG - Intronic
1065920928 10:30392336-30392358 TAGGGGAAAGACAGAGATGTGGG + Intergenic
1065926093 10:30434607-30434629 TACGGGAAGGAGGAGGAAGGGGG - Intronic
1066057163 10:31692681-31692703 TAGAAGAAAGAGAGGGATGGGGG + Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1067056950 10:43058060-43058082 TGGGGGATGGAGAAGGAGGGAGG - Intergenic
1067156075 10:43782342-43782364 CAGGGCAAAGTGAAGGCTGGTGG - Intergenic
1067364012 10:45608142-45608164 GAAGGGAAAGGGAAGGAAGGGGG + Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1067935874 10:50611793-50611815 GAGGGGAGAGGGAAGGGTGGAGG - Intronic
1068000799 10:51331769-51331791 TAGGGGGCAGAGAAAGATGATGG - Intronic
1068195735 10:53713820-53713842 AAGGGGAGAGAGCAAGATGGAGG - Intergenic
1068206102 10:53856121-53856143 CAGGGGAAAGGGTGGGATGGAGG + Intronic
1068343133 10:55735032-55735054 TTGAGGAAAGAAAAGGAAGGAGG - Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068550625 10:58404037-58404059 TTTTGGAAAGAGAAGGATTGGGG + Intergenic
1068732925 10:60379716-60379738 TAGGGGAAAGGGAGGTATAGAGG + Intronic
1069031638 10:63602253-63602275 TGGGGGAAAGAGAAGGAAAGTGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG + Intronic
1069775628 10:70925642-70925664 TAGGAGAGAGAGAGGGCTGGAGG + Intergenic
1069929719 10:71874273-71874295 TGGGGAAAAGAGAAGGATCCCGG - Intergenic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070153949 10:73821959-73821981 AAAGAGAAAGAGAAGGATTGAGG - Intronic
1070161381 10:73868686-73868708 TGAGGGAAAGAGAAGGGAGGGGG - Intronic
1070470900 10:76778412-76778434 TAGGGTAGAGAGCAGGATTGAGG - Intergenic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070510878 10:77159588-77159610 TAGGGGAAAAGCAAGGATGTAGG - Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070823368 10:79375995-79376017 GAGGGCTAAGAGAAGGCTGGTGG + Intergenic
1071062421 10:81588475-81588497 GAGGGGAAACAGAAAGCTGGGGG + Intergenic
1071094025 10:81952411-81952433 GAGGGGAGAGAGAAAGAAGGCGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071471570 10:85987441-85987463 TTGGGGAGAGATAAGGCTGGGGG - Intronic
1071471585 10:85987492-85987514 TAGGGGGAAGGTAAGGCTGGGGG - Intronic
1071570653 10:86694947-86694969 GAGGAGAAAGAGAAGGTAGGTGG - Intronic
1071665729 10:87555677-87555699 TAGGGGTAATAGAATCATGGAGG - Intergenic
1071756200 10:88543094-88543116 AAGGGGAAAGAGTAGAAAGGTGG - Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071778603 10:88817350-88817372 TGTGTGAAAGAGAGGGATGGGGG + Intronic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1072276587 10:93829284-93829306 AAGGGGAAAGAGAAAGAGAGTGG - Intergenic
1072367996 10:94733946-94733968 GAGGGGAAAGCGCAGGATGTTGG + Intronic
1073012555 10:100372916-100372938 CAGGGGAAAGAGAAGTCTGTGGG - Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073661617 10:105482176-105482198 TAGATGCAAGAGAGGGATGGGGG - Intergenic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1073874244 10:107902853-107902875 TAGGGGAAAGTCAGGGATGCGGG - Intergenic
1074827921 10:117228240-117228262 AAAGGGAAGGGGAAGGATGGAGG - Intergenic
1074827982 10:117228444-117228466 GAGGAGGAAGGGAAGGATGGAGG - Intergenic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075229628 10:120664373-120664395 TAAGGAAAAGAAAGGGATGGGGG + Intergenic
1075640695 10:124062335-124062357 TTGTGGAAAGAGAAACATGGCGG + Intronic
1075922882 10:126227722-126227744 GAGGGGAAAGAGAAAGGTGATGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076068095 10:127464703-127464725 TAGGAGCAGGAGGAGGATGGGGG + Intergenic
1076595926 10:131623931-131623953 TGGGGGAAAGAGATGGAGAGAGG + Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1076935655 10:133566511-133566533 TAGGGGTAGGGGAAGGATTGGGG + Intronic
1077167551 11:1150611-1150633 TAGGGGAACCAGAGGCATGGGGG + Intergenic
1078045392 11:7909719-7909741 TGGGGGTAAGACAAGGTTGGAGG - Intergenic
1078738179 11:14041188-14041210 TTGGGGAAGAAGGAGGATGGGGG - Intronic
1078766061 11:14299775-14299797 TGGGGGCAAGAGAAGGATTGGGG + Intronic
1078804960 11:14689638-14689660 TAGGAGAAAGACAAGGACTGTGG + Intronic
1078841875 11:15084768-15084790 TAGGGGAAAGTGCAGAAGGGGGG - Intergenic
1079117279 11:17647826-17647848 TGTGGGAAGGAGAAGGAGGGGGG + Intergenic
1079206188 11:18416828-18416850 GAGAGGAAAGGAAAGGATGGAGG - Intronic
1079296958 11:19242148-19242170 TAGGAGGAAGAGGAGGAAGGCGG + Intergenic
1079470622 11:20774149-20774171 GAGGGGAGAGGGAGGGATGGAGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079713242 11:23712789-23712811 AAGGGGAGAGGAAAGGATGGGGG - Intergenic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080032946 11:27681113-27681135 TTGTGGAAACACAAGGATGGGGG + Intronic
1080036856 11:27719772-27719794 AGGGGGAAAGAGAGGGAGGGAGG + Intronic
1080053922 11:27885500-27885522 TCGGGGAAATAGAATGATGAAGG + Intergenic
1080152546 11:29070877-29070899 TGGGGGAAAGAGTGGGAGGGAGG - Intergenic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081030650 11:38077482-38077504 TAGGGGGAAGGACAGGATGGGGG + Intergenic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1082847541 11:57738776-57738798 TAGTGCAAAGGGAGGGATGGTGG + Intronic
1083477022 11:62921403-62921425 AAAGGGAAAGAGAGGGAGGGAGG + Exonic
1083712586 11:64558404-64558426 AAGGGGAAAGAGAGAGGTGGAGG + Intronic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1083995392 11:66269115-66269137 CAGGAGAAAGAGAAGGGTAGAGG - Intronic
1084441855 11:69179126-69179148 TGGGGAGAAGAGAAGGAAGGAGG + Intergenic
1084985734 11:72869411-72869433 GAAGGGAAAGAGAGGGTTGGGGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085158343 11:74317520-74317542 AAAGAGAAAGAGAAGGAAGGAGG - Intergenic
1085190725 11:74619442-74619464 TTGGGAAAGAAGAAGGATGGAGG + Intronic
1085498600 11:76996121-76996143 AGGGGGAAAGACAAGGATGATGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086738081 11:90332138-90332160 GAGGGGAGAGAGGAGAATGGAGG + Intergenic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1087302259 11:96449402-96449424 TAGGGGAAACTGAAGGCTTGAGG - Intronic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087938474 11:104063703-104063725 CACGGGAGAGAGAATGATGGGGG + Intronic
1088598689 11:111457561-111457583 AAGGGGAGAGGGAAGGTTGGGGG - Intronic
1088779069 11:113116338-113116360 GAAGGGAAAGAGAAGGGTGGTGG + Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089139269 11:116273199-116273221 TAGGGGAGAGAGAGGAAGGGAGG + Intergenic
1089400820 11:118163638-118163660 TAGGAGGAAGAGACAGATGGGGG + Exonic
1090003938 11:122984127-122984149 CAAGGGAAAGATAAGGACGGAGG - Intergenic
1090062620 11:123477252-123477274 GAGGGGGAAGGGAAGGAAGGGGG - Intergenic
1090504975 11:127301257-127301279 AAAGGGAAAGAGTAGGAAGGGGG + Intergenic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091200051 11:133771595-133771617 TAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1091300159 11:134502471-134502493 TGGGGGAGAGAGAGGGAAGGAGG - Intergenic
1091375509 12:22488-22510 CAGGGGAGAAGGAAGGATGGAGG + Intergenic
1091392089 12:131785-131807 TAGGGGACAGTGCAGGTTGGGGG + Intronic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091899979 12:4136753-4136775 TGGGGGGAAGGGAAGGATCGAGG - Intergenic
1092120544 12:6040713-6040735 CATGGGAATGAGGAGGATGGGGG - Intronic
1092137698 12:6161133-6161155 TGGGAGAGAGAGAAGGGTGGAGG + Intergenic
1092674151 12:10897695-10897717 CAGGAGGAAGAGAAAGATGGGGG + Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093741463 12:22693707-22693729 CGGGGGAAAAAGAGGGATGGGGG - Intergenic
1094252965 12:28387535-28387557 TGGGGGAAAGGGTAGGAAGGGGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094340199 12:29402551-29402573 TGGTTGAAAGAGAAAGATGGAGG + Intergenic
1095160594 12:38910277-38910299 GAGGGGGATGGGAAGGATGGAGG - Intergenic
1095247571 12:39940859-39940881 GAGGGGGAAGAGTGGGATGGGGG - Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096571082 12:52523728-52523750 TGAGGGAAGAAGAAGGATGGAGG - Intergenic
1096718238 12:53503650-53503672 TAGGGGGAAGAGAGGGGTGGGGG - Intronic
1097223370 12:57462882-57462904 GAGGGGCACGAGAAGGAAGGGGG + Intronic
1097357992 12:58623446-58623468 TAGGGGAAACAGAACAATGAAGG - Intronic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1097844205 12:64350138-64350160 TAGGGGGAAGGGTAGGAGGGAGG + Intronic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098520795 12:71433263-71433285 TGGGGGAAAGTGGGGGATGGGGG - Intronic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100366169 12:93922794-93922816 TTGGGTAAAGAGATGGGTGGAGG + Intergenic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1100457352 12:94765252-94765274 TAGGAGAACGAGATGGTTGGGGG - Intergenic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100622109 12:96287289-96287311 GAAGGAAAAGAAAAGGATGGTGG + Intronic
1100643287 12:96503268-96503290 AAGGGGAAAGGAAAGGAAGGGGG - Intronic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100974337 12:100106607-100106629 TAGGGGTAGGAGAGGGATGAGGG + Intronic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101757326 12:107631087-107631109 TAGGAGAGAGAGAAGGAAGGAGG - Intronic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102015777 12:109646969-109646991 AAGGTGAAAGAGAAGGATAAAGG - Intergenic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102484002 12:113243941-113243963 TAGGGGACAGAGGAGAATGTAGG - Intronic
1102997668 12:117362224-117362246 CTGGGGAGAGTGAAGGATGGAGG + Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104112984 12:125721584-125721606 AAGGGGTAAGAAAAGGAAGGAGG + Intergenic
1104232898 12:126902585-126902607 AAAGGGAAAGAGAAAGAGGGAGG - Intergenic
1104520618 12:129471490-129471512 GAGGAGAGGGAGAAGGATGGAGG - Intronic
1104524608 12:129507703-129507725 AAGGGGAAAGGGTAGGAAGGGGG + Intronic
1104649776 12:130523220-130523242 TAGGGGACAGAGAGAGATGGAGG - Intronic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1105282644 13:18977369-18977391 TATGGGAAACAAAGGGATGGGGG - Intergenic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105634492 13:22204135-22204157 TTGGGGAGAGAGCAGGATGAGGG + Intergenic
1105887918 13:24658288-24658310 TAGGGGAAAGTGTATGTTGGGGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106062026 13:26302695-26302717 TAGGGGAGAGATATTGATGGGGG + Intronic
1106227975 13:27799348-27799370 CAAGGGCAAGAGAAGGGTGGTGG + Intergenic
1106372898 13:29153721-29153743 TAGGAGGAAAAGAAGGATGCAGG - Intronic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107100572 13:36586504-36586526 TAGGGAAGAGAGATGGGTGGAGG - Intergenic
1107123250 13:36818432-36818454 TAGGCGAAAGAATAGGATGAAGG + Intergenic
1107608322 13:42085314-42085336 TTGGGGAGAGAGAAGCATAGGGG - Intronic
1107960832 13:45556545-45556567 AAGGGGAAAGGGTAGGAAGGGGG - Intronic
1108060776 13:46530904-46530926 TAGGGGAAAGAGACGGGGGGGGG + Intergenic
1108364272 13:49694250-49694272 TTGGGGAGAGAGAAGTATCGGGG - Intergenic
1109759720 13:66812066-66812088 TAGGGGGAAGAGTGGGAAGGGGG - Intronic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110229478 13:73153380-73153402 TTGTTGAAAGAGAAGGAGGGAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110416899 13:75262835-75262857 TAGGGGAATCAGAAGTTTGGGGG - Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110745912 13:79053359-79053381 TAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1110800758 13:79691926-79691948 TAGGAGAAAAAGAGAGATGGAGG + Intergenic
1110928249 13:81182984-81183006 TAGGGGCCAGAGTAGGAGGGAGG + Intergenic
1111073061 13:83195071-83195093 AAGGGGAAAGGAAGGGATGGTGG + Intergenic
1111215905 13:85140578-85140600 AAGGGGAAAGAGTAGGCAGGAGG + Intergenic
1111252523 13:85621735-85621757 TGGGGGAAATGGAAGGATGTTGG + Intergenic
1111623230 13:90750557-90750579 TAGGGGATAGAAAGTGATGGCGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111887595 13:94042158-94042180 TAGGAGGAAGAGAGGGAAGGGGG - Intronic
1111898765 13:94174469-94174491 TAGGGAAAAGAGACAGATGTAGG + Intronic
1112636055 13:101219308-101219330 TAGGGTAAGGGGAATGATGGAGG + Intronic
1112870694 13:103967574-103967596 TGGGGGAAAGAGAAGTATTACGG + Intergenic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113266400 13:108622664-108622686 GATGGAAAAGAGAGGGATGGTGG + Intronic
1113339633 13:109409483-109409505 CAGGAGAAAAAGAAGGTTGGTGG + Intergenic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113841688 13:113364434-113364456 TTGGGGAGAGAGGAGGGTGGGGG + Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114320020 14:21539457-21539479 GAGGGGAAGGAGAGGGATAGAGG + Intergenic
1114412041 14:22509919-22509941 GAGGGGAAAGAGAAGGCTAAGGG + Intergenic
1114453073 14:22838853-22838875 TGGGGGGAGGAGAGGGATGGGGG + Intronic
1114547452 14:23513158-23513180 TCGGGGAGAGAGAGGGAGGGAGG + Intergenic
1114551282 14:23534175-23534197 GAGGGGCAAGAAGAGGATGGAGG - Exonic
1115018863 14:28650278-28650300 TAGAGGCAAGAGAAGGGTTGAGG - Intergenic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116403783 14:44542864-44542886 GAGGTGAGAGAGAAGGAAGGGGG + Intergenic
1116651893 14:47604255-47604277 GAGGGGAGAGAAAGGGATGGAGG - Intronic
1117061634 14:51969999-51970021 TTGGGGACAGAGAAAGGTGGGGG + Intronic
1117179784 14:53180592-53180614 TAGGGGAAGGCGAAGGAGAGGGG - Intergenic
1117342404 14:54803581-54803603 TATGGGACAGGGCAGGATGGGGG + Intergenic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1117838991 14:59838092-59838114 GAGGGGAGAGAGAGGGATAGGGG - Intronic
1118147492 14:63156416-63156438 TGGGGAAAAAAGAACGATGGGGG - Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118701226 14:68435172-68435194 GATGGGGAAGAGGAGGATGGGGG - Intronic
1118739716 14:68730916-68730938 GAGGTGAAAGTGAGGGATGGGGG - Intergenic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1119664259 14:76473347-76473369 TAAGGGGAAGAGAAGGGTGTTGG + Intronic
1120575501 14:86175720-86175742 GAGGGGAGAGGGAGGGATGGAGG + Intergenic
1120766665 14:88333671-88333693 AAGAGGTATGAGAAGGATGGAGG - Intergenic
1120876680 14:89381870-89381892 AAGGGGAAAGGGAGGGACGGAGG + Intronic
1121085102 14:91139892-91139914 AAGGGGAGAAAGCAGGATGGAGG + Intronic
1121439051 14:93937327-93937349 GAGGGGAGAGGGGAGGATGGTGG - Intronic
1122014905 14:98786993-98787015 TAGGGGAAATAGCAGCCTGGTGG + Intergenic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1122366528 14:101197912-101197934 GTGGGGAGAGAGCAGGATGGAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1124394702 15:29291080-29291102 TAGGGGGAAGAAAGGGATGGGGG - Intronic
1124441241 15:29687864-29687886 TTGGGGAAAGAAAAGCAGGGAGG + Intergenic
1124683030 15:31753447-31753469 TTGGGGAAAGAGTGGGAAGGGGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125751359 15:42031523-42031545 TGGGAGAAAGAGGAGGATGAAGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126394349 15:48197344-48197366 AAGTAGAAAGAGAATGATGGTGG - Intronic
1126705650 15:51402663-51402685 TAAGGGTAGGAGAAGGATGAGGG - Intronic
1126739880 15:51766835-51766857 TAGGGGAAAAAGAAGGAAAGAGG + Intronic
1126790025 15:52212473-52212495 GAGGGGAAAGAAAAGGGTAGAGG + Intronic
1127566124 15:60190152-60190174 TAGGAAAAAGAGAAGCATGTTGG + Intergenic
1127700871 15:61499245-61499267 TGGGAGAAAAAGAAGGCTGGGGG + Intergenic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1127823099 15:62677688-62677710 AAAGGGAGAGAGAAGGAAGGAGG - Intronic
1128016074 15:64348390-64348412 TAGGGGAAACTGGGGGATGGAGG + Intronic
1128227334 15:66011241-66011263 GAGGGGACTGAGAAGGAAGGTGG + Intronic
1128427685 15:67558807-67558829 TAGTGGAAAGAGACTGAAGGAGG - Intronic
1128550759 15:68596619-68596641 TAGGTGAAGGATAAGGCTGGAGG + Intronic
1128638318 15:69317389-69317411 TAGGGGTCAGAGAAGGCTGCAGG - Intronic
1128793392 15:70449080-70449102 ATGGAGGAAGAGAAGGATGGAGG + Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129160253 15:73743368-73743390 TGGAGGAAAGAGAAAGAGGGAGG + Intronic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129311646 15:74716659-74716681 TAAGGAAAAGAAAGGGATGGAGG - Intergenic
1129667085 15:77585261-77585283 TGGGGGAGAGAGCAGGGTGGTGG + Intergenic
1129735485 15:77959250-77959272 TAGGGGAAAGACAGAGATGTGGG + Intergenic
1129924606 15:79352063-79352085 GGGGGGAAAGAGTAGGAGGGGGG + Intronic
1130510804 15:84587799-84587821 TAGGGGAAAGACAGAGATGTGGG + Intergenic
1130742165 15:86612436-86612458 TCGGGGGAGGGGAAGGATGGGGG + Intronic
1131080049 15:89527114-89527136 CCAGAGAAAGAGAAGGATGGTGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1131923385 15:97354658-97354680 TAAAGGCAAGAGAATGATGGTGG - Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132016216 15:98319766-98319788 TATGGAAAAGAGGAGGAGGGAGG + Intergenic
1133191316 16:4135662-4135684 TAGAGGATAGGGATGGATGGAGG + Intergenic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133712229 16:8412319-8412341 TAGGGGGAAGAGTAGGAGGGAGG + Intergenic
1134278859 16:12800757-12800779 GATGGGAAAGGGAAGGATGAGGG - Intronic
1134318918 16:13144895-13144917 TAGGCAAGAGAGAAGGAGGGAGG + Intronic
1134396930 16:13873797-13873819 TAGGGGAGGGAGAAGGCTGGGGG - Intergenic
1134509516 16:14834776-14834798 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134697221 16:16233592-16233614 AAGAGGAAAGGGATGGATGGAGG + Intronic
1134974625 16:18561082-18561104 AAGAGGAAAGGGATGGATGGAGG - Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135604373 16:23810460-23810482 TAGGAGAAAGGGAGGGATAGGGG + Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136234153 16:28904153-28904175 AAGGGGAAAGAGAAGGGATGAGG - Intronic
1136553230 16:30992794-30992816 TCTGGGAGAGAGAAGGGTGGGGG + Exonic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137436618 16:48459805-48459827 TAGGGGAAAGGGAATGAGGGAGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139272422 16:65696721-65696743 AAGAGGAAAGAGAAAGAAGGAGG + Intergenic
1139543502 16:67636638-67636660 TGGGGCAAGGAGAAGGGTGGTGG - Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140093465 16:71855547-71855569 TAGGGGGAAGCACAGGATGGTGG + Exonic
1140098612 16:71895710-71895732 GAGGAGAAAGGGAAGGATAGTGG + Intronic
1140350454 16:74257479-74257501 TCAGGGAAAGAGAAGCATCGTGG + Intergenic
1140491303 16:75338221-75338243 TTGGGGAATGTGAAGCATGGGGG + Intronic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1140970427 16:80007238-80007260 AAAGGTAGAGAGAAGGATGGTGG - Intergenic
1141108049 16:81249777-81249799 TAGGTCTAAGAGAAAGATGGAGG - Intronic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142749541 17:1978875-1978897 TAGGGCCCAGAGAAGGGTGGAGG + Intronic
1143303847 17:5930588-5930610 AAGGGGAGAGGGAGGGATGGGGG - Intronic
1143638714 17:8182563-8182585 GTGGGGAGAGGGAAGGATGGGGG + Intergenic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1143915180 17:10286426-10286448 TAGGGAGAAAAGAGGGATGGAGG - Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144254524 17:13453533-13453555 CAAGAGAAAGAGAAAGATGGGGG - Intergenic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145204557 17:20976063-20976085 GAGGGGGAAGAGGATGATGGAGG - Intergenic
1145961116 17:28887009-28887031 TAGGGGAGAGGGAGGGAGGGAGG + Intronic
1146033963 17:29390394-29390416 TCGGGGAGAGAGAGGGAGGGTGG + Intergenic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1146538188 17:33671521-33671543 TATGGGAAAGACAAGGAAGGAGG + Intronic
1146693715 17:34893450-34893472 TGTGGGAAAGTGGAGGATGGAGG - Intergenic
1146841182 17:36155368-36155390 CAGGGGAAAAAAAAGGGTGGGGG + Intergenic
1147136722 17:38438350-38438372 TTGGGGCAAGAAAGGGATGGAGG + Intronic
1147417520 17:40304091-40304113 CAGGGGAAAGGGAAAGATAGAGG - Exonic
1147454126 17:40524603-40524625 TAGGGGAAGGAGCAAAATGGGGG - Intergenic
1147839843 17:43363537-43363559 TTTGGGAAAGCGCAGGATGGAGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148147757 17:45376767-45376789 TGGGGGTAAGATAAGGATGTGGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148731842 17:49841586-49841608 TGGGGGAAGGAGAAGGAATGAGG + Intronic
1148812941 17:50306139-50306161 TAGGGGATAGAGAAATATGAGGG - Intergenic
1149036126 17:52136157-52136179 TAAGAGAAAGTGACGGATGGAGG + Intronic
1149603709 17:57910155-57910177 TAAGGAAAAGAAAGGGATGGAGG - Intronic
1149984931 17:61340150-61340172 TAAGGGAAAGAGAGAAATGGGGG + Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150077596 17:62206583-62206605 AAGGGGGAAGGGGAGGATGGTGG - Intergenic
1150322731 17:64230166-64230188 TAGGGGAAAGAGTGGGACTGAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150653369 17:67024179-67024201 TAGGTGATAGACAAGGATGTGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150869355 17:68888548-68888570 TAGAGGCAAGAGAAGAATTGAGG + Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1151072170 17:71227157-71227179 AAGGGGTAAGAGAAGGGTAGGGG + Intergenic
1151522977 17:74643921-74643943 TAGAAGAGAGAGAAGGAAGGTGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151835646 17:76581203-76581225 AAGGGGCAAGGGAGGGATGGGGG - Intronic
1152297467 17:79476432-79476454 TAGGGCAAAGAAAAGGATAGAGG + Intronic
1152456852 17:80421726-80421748 TAAGGGAGAGGGAAGGATGAGGG + Intronic
1152799781 17:82325483-82325505 GAGGGGAAAGGGAATGTTGGGGG - Intronic
1153082807 18:1248135-1248157 TAGGGGAAAGGGAAAAATAGGGG - Intergenic
1153400962 18:4683209-4683231 GAGGGGACAGAGAGAGATGGAGG + Intergenic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153826630 18:8881445-8881467 TAGGGGAAAGGGAAGGAGAGAGG - Intergenic
1155520799 18:26667192-26667214 AAAGGGAAAGAGAAAGAAGGAGG - Intergenic
1155522701 18:26685184-26685206 CAAGGGAGAGAGAAGAATGGTGG + Intergenic
1155671714 18:28379660-28379682 TAGGGGAAAGAGAAGATTCTGGG + Intergenic
1155780402 18:29825510-29825532 TAGGGTAAAGAGTAGGACAGTGG - Intergenic
1155784370 18:29879035-29879057 AAGAGGAAAGAGTAGGATTGGGG - Intergenic
1155825066 18:30431144-30431166 AAGGGGGAAGGGAATGATGGTGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1156527212 18:37778413-37778435 TAGGGGAAAGGGAAGGGCTGGGG - Intergenic
1156794201 18:41022272-41022294 GAGGGGACAGAGAAAGAAGGTGG + Intergenic
1157024057 18:43821753-43821775 AAGGGGAAAGGGTGGGATGGGGG + Intergenic
1157281272 18:46347755-46347777 TAAGGGAAATAAAAGGAAGGGGG + Intronic
1157467500 18:47959993-47960015 GAAGGCAAAGAGTAGGATGGTGG - Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1157897596 18:51483684-51483706 TATGGAGCAGAGAAGGATGGAGG - Intergenic
1158184537 18:54756467-54756489 TAGGGGCTAAAGAAGGCTGGAGG - Intronic
1158398465 18:57098364-57098386 TAGGGGAAAGGGTGGGAAGGAGG + Intergenic
1158444551 18:57508047-57508069 TAGGGGAGTGAGAAGGTAGGTGG - Intergenic
1158475432 18:57775325-57775347 AAAGAGAAAGAGAAGGAAGGAGG + Intronic
1159736874 18:72111012-72111034 TAGAAGAAAGTGAAGGAGGGAGG + Intergenic
1160248055 18:77176250-77176272 AAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1160683393 19:422861-422883 TAGGGGCAAGAGAGGGGTGCCGG - Intronic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161451756 19:4350255-4350277 TAAGGGAGAGAGAAGGAGGTGGG + Intronic
1161541016 19:4851640-4851662 AAGGGGGAAGAGGAGGAGGGCGG + Intronic
1162270215 19:9608239-9608261 GAGGGGAAGGAGAGAGATGGTGG + Exonic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163093244 19:15035953-15035975 AGGGAGGAAGAGAAGGATGGAGG + Intergenic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1163964277 19:20729960-20729982 TGGGGGAAAGAACAGGAAGGGGG + Intronic
1163976623 19:20858847-20858869 TAGGGGAAAGGGAAGGAGAGGGG + Intronic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164744203 19:30599265-30599287 AAGGAGAGAGACAAGGATGGGGG - Intronic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1165385231 19:35506427-35506449 TTGGGGACAGACCAGGATGGAGG - Intronic
1165405959 19:35631301-35631323 GAGGGGAGAGGCAAGGATGGTGG - Intronic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165759563 19:38312927-38312949 TAGGGGAAAGAAAAGGGAAGTGG - Intronic
1165779482 19:38423932-38423954 TAATGGAGAGACAAGGATGGTGG + Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165988266 19:39789712-39789734 CAGGGGAAAGAATGGGATGGAGG + Intergenic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166971010 19:46567794-46567816 TGGGGGAAAGAGAGGGAGTGGGG + Intronic
1167268472 19:48494730-48494752 CAGGGGCAAGAGGAGGGTGGAGG + Intronic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167642872 19:50691434-50691456 GAGGGGAGGGAGAAAGATGGAGG - Intronic
1167685412 19:50952863-50952885 GAGGGGACAGAGAAAGATGTGGG + Exonic
1167724296 19:51200247-51200269 GAGGGGAGAGGGAAGGATGGGGG - Intergenic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
1168362111 19:55750521-55750543 TGGGGGGAAGAGAGGGAGGGGGG - Intergenic
1168502624 19:56906141-56906163 TAGGGGTGAGAGAAGGATCTGGG + Intergenic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925062983 2:907594-907616 TGGGGGACAGAGAAAGAAGGAGG + Intergenic
925159817 2:1676177-1676199 TAGGGGGAAGAGATGGGAGGAGG - Intronic
925397728 2:3548226-3548248 TAGGGGAAAGGGAAGAGAGGAGG - Intronic
925812336 2:7712732-7712754 TAGGGGAAAGAGCAGGACACAGG + Intergenic
925842591 2:8006582-8006604 GAGGAGGAAAAGAAGGATGGAGG - Intergenic
925908729 2:8557239-8557261 TAGGGGAAAAAAAAGGGGGGTGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927327903 2:21827591-21827613 TGGGGGAAAGAGAGGGAGGGTGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928331978 2:30364629-30364651 TAGGGGGAAGAGAAGAGGGGAGG + Intergenic
928407990 2:31029606-31029628 AAGGGGAAAGAGAGGGGCGGAGG - Intronic
928443497 2:31312799-31312821 TAGTGGAGAGAGAAGGAAAGAGG - Intergenic
928750536 2:34466199-34466221 TAAGGAAAAGAGTAGCATGGTGG + Intergenic
929055906 2:37875706-37875728 TAAGGGAAAGAGGAGGGAGGGGG + Intergenic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929303683 2:40334925-40334947 TAGGGGGAAGACAAGGACAGTGG - Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929615242 2:43301554-43301576 TAGGTGGAACAGAAGGTTGGAGG + Intronic
930301277 2:49618968-49618990 TGGGGGAAACAGGAGGTTGGGGG + Intergenic
930459476 2:51654020-51654042 TAGGGGAATGGGGAAGATGGGGG + Intergenic
931055351 2:58463437-58463459 TAGGGGGAAGAGTGGGAGGGAGG - Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931399991 2:61922799-61922821 TAGGAGAAAGATAAGAAAGGGGG + Intronic
931881474 2:66575423-66575445 AGGGGGAGAGAGGAGGATGGGGG - Intergenic
932100061 2:68890426-68890448 TGGGGGAAAGAGTGGGACGGGGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932439268 2:71721545-71721567 TGAGGGAAAGAGAAGGAGTGTGG - Intergenic
932542367 2:72668766-72668788 GAGGGGAGAGAGAATGATAGGGG + Intronic
932697205 2:73966932-73966954 GTGGGGAAAGATAAGGCTGGAGG - Intergenic
932903605 2:75726473-75726495 TAGGAGCAAGAGAGAGATGGGGG + Intergenic
933182044 2:79238223-79238245 AAGGGGAGAGAGAGAGATGGGGG + Intronic
933875737 2:86620117-86620139 AGTGGGAAAGAGAAAGATGGGGG - Intronic
933875989 2:86622925-86622947 TACGGGAGAGAGAAGGGTCGAGG + Exonic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934791664 2:97067487-97067509 AGCGGGAGAGAGAAGGATGGAGG - Intergenic
934948638 2:98560776-98560798 TAGGGCCAAGAGAGGGCTGGTGG + Intronic
935283753 2:101545138-101545160 AAGGGGAAAGAGTGGGAAGGAGG - Intergenic
935379755 2:102439644-102439666 TAGGAGAAAGAGAAGAATCAAGG + Intronic
935690268 2:105724969-105724991 TAGGGGAAAGGGTGGGAAGGGGG + Intergenic
936496925 2:113030355-113030377 TGGGTGAAATAGAAGGTTGGGGG + Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
936866663 2:117082300-117082322 TAGGGGTGAGAGGAGGATGGTGG - Intergenic
936983712 2:118288324-118288346 GAGGGGATAGAGAAGGAATGAGG + Intergenic
937265736 2:120613696-120613718 GAGGGGAAAGAGAACGCTGGAGG - Intergenic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
937854925 2:126665539-126665561 TAGGGCACAGATAAGGCTGGAGG + Intronic
937972106 2:127558885-127558907 TCGGGGAAAGGGAGGGAAGGGGG + Intronic
938109604 2:128554978-128555000 TGGGGGAAGGAGAGGGGTGGAGG + Intergenic
938698796 2:133858384-133858406 TGGGGGAAAGAGAGGGAGAGAGG + Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939202031 2:139048262-139048284 GGAGGGAAAGAGAAGGAGGGGGG + Intergenic
939327705 2:140715340-140715362 TAGGGTAAAGATAAAGATAGAGG + Intronic
940005901 2:149009435-149009457 TAGGGGACCCAGATGGATGGAGG - Intronic
940010147 2:149044585-149044607 TTGGAGGAAGAGAAGGAGGGAGG - Intronic
940300468 2:152172010-152172032 AAGGGGAAAGTGAAACATGGGGG - Intronic
940579848 2:155564712-155564734 TAGGCGGAAGAGAGGGAGGGAGG - Intergenic
940768195 2:157812307-157812329 TAAGGGAAAGAAAGGGCTGGAGG + Intronic
940878342 2:158921446-158921468 TAGGGGAAGGAGAGGGAGTGGGG - Intergenic
941069616 2:160941149-160941171 TAGGGGAGAGAGAAAGACAGGGG + Intergenic
941152576 2:161933155-161933177 AAGGGGAAAGAGAAAGAAAGAGG - Intronic
941161519 2:162040827-162040849 TAGGGGAAAGTGGGGGAGGGAGG + Intronic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
941994852 2:171592685-171592707 TAAGGGAGAGAAAAGGATGCAGG - Intergenic
942490277 2:176483054-176483076 AAAGGGAAAGAGAAGGTTGCAGG + Intergenic
942534187 2:176946059-176946081 TAAGGGAGAGAGAAGGCGGGGGG - Intergenic
942892536 2:181008660-181008682 TAGTGGTGAGAGGAGGATGGAGG + Intronic
942942232 2:181631778-181631800 AAGGGGAAAGAGAAGGAAATGGG + Intronic
943037580 2:182766100-182766122 AAGGGGAAAGAGAATGCTGTTGG + Intronic
943139013 2:183954768-183954790 TAAGAGAAAGGGAAGGAGGGAGG + Intergenic
943676375 2:190719872-190719894 TATGGGAAAGGGAAGAATAGAGG + Intergenic
944133407 2:196371096-196371118 TAGGGGGCAGAGCAAGATGGTGG - Intronic
944494685 2:200294889-200294911 TTGGGAAAAGAGAATGCTGGTGG + Intergenic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
944585662 2:201171145-201171167 TAGGGGAAAGGGTGGGAGGGGGG + Exonic
945455657 2:210049301-210049323 GAGAGGAAAGAGAAGTGTGGTGG - Intronic
945607557 2:211954630-211954652 TAGGGAACAGAGAACTATGGTGG + Intronic
946027699 2:216681756-216681778 TGGGGGACACAGAAGCATGGTGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946458402 2:219848412-219848434 GAGGGGATGGAGCAGGATGGTGG + Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
948737519 2:240018937-240018959 TGGGGGCAGGAGCAGGATGGGGG - Intronic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1168749847 20:274679-274701 TAGGTGAAAGAGACTGATGGGGG - Intronic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169290586 20:4347534-4347556 TGGGGGAAAGAGTGGGAGGGGGG + Intergenic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1170293313 20:14795335-14795357 TAGGGAAGAGATAAAGATGGTGG + Intronic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1171192802 20:23171338-23171360 TGGGGGGAAGGGAAGGAGGGGGG - Intergenic
1171902282 20:30868901-30868923 TCGGGGGAAGAGAGGGGTGGTGG - Intergenic
1172250440 20:33475751-33475773 GAGGGGAGAGTGAAGGATGCTGG - Intergenic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1172438269 20:34945929-34945951 TAGGGGACAGTGAAGCATTGGGG - Intronic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172791279 20:37507166-37507188 TAGGAGAAAGAGCAGGTTTGGGG - Intronic
1173064388 20:39696245-39696267 AAGGGGAAAGAGAGAGAGGGAGG + Intergenic
1173149965 20:40558603-40558625 AAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1173262317 20:41447516-41447538 TAAGGCAAAGAACAGGATGGTGG + Intronic
1173473424 20:43341080-43341102 TATTTGAAAGAGAAAGATGGGGG + Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173583661 20:44165662-44165684 TGAGGGAAAGGGGAGGATGGCGG - Intronic
1173754311 20:45501580-45501602 AAGGAGAGAAAGAAGGATGGTGG - Intergenic
1174238106 20:49110846-49110868 TAAGTGAAGGACAAGGATGGAGG + Intergenic
1174304436 20:49605192-49605214 TAAGGAAAAGAAAGGGATGGAGG - Intergenic
1174506333 20:51020072-51020094 TGGGGGCAAGGGAGGGATGGAGG - Intronic
1174572074 20:51509022-51509044 CAGGGGAAGGGGAAGGATAGGGG - Intronic
1174872315 20:54194658-54194680 TCTGGGAAAGAGACTGATGGAGG + Intergenic
1174943916 20:54963795-54963817 TCAGGGAGAGAGAAGAATGGTGG + Intergenic
1174992978 20:55534179-55534201 TGGGGGAAAGAAAAGGAAGAAGG + Intergenic
1175021439 20:55855005-55855027 TAGGGGAGAGAGAATAATGAGGG + Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1175891484 20:62317933-62317955 TGAGGGAAGGAGGAGGATGGAGG + Intronic
1176019550 20:62955654-62955676 TAGTGGAAAGTTAAGGGTGGGGG + Intronic
1177567108 21:22838177-22838199 GAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1178103146 21:29291628-29291650 TAGGGTACAGAGAAGTGTGGAGG + Intronic
1178142238 21:29697719-29697741 TATGGGGAGGAGAAGGAGGGAGG - Intronic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1178777043 21:35561848-35561870 TAGGAGAAAGAGAACAATGGAGG + Intronic
1178796882 21:35752935-35752957 AAGGGGAAAGATAGGGAAGGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179346626 21:40564470-40564492 TAGAGGAAGGAGGAGGGTGGTGG - Intronic
1179399505 21:41070789-41070811 TAGGAGGAAAAGAAGGATGGAGG + Intergenic
1179535964 21:42052351-42052373 TAGGGGGAAGAGTTGGAGGGGGG - Intergenic
1179944242 21:44660094-44660116 AAAGAGAAAGAGAAGGGTGGAGG + Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1181082133 22:20422984-20423006 TGGGGGGAAGGGAAGGCTGGTGG + Intergenic
1182710896 22:32322640-32322662 GCTGGGAAAGAGCAGGATGGGGG + Intergenic
1183004979 22:34893744-34893766 AAAGGGACAGAAAAGGATGGGGG + Intergenic
1183422358 22:37719258-37719280 GAGGGGACAGAGAAGGAGAGAGG + Intronic
1183512157 22:38242634-38242656 GAGGGGAAATACAAGGATCGGGG + Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184109066 22:42384586-42384608 TGGGGGACAGACAAGGATGATGG - Exonic
1184835706 22:47019804-47019826 AAGGGAGAAGCGAAGGATGGAGG - Intronic
1184835744 22:47019956-47019978 TAAGGGAGAGGGGAGGATGGAGG - Intronic
1184835753 22:47019981-47020003 TAAGGGAGAGGGGAGGATGGAGG - Intronic
1184838269 22:47036861-47036883 TACAGGAAAGCGAAAGATGGTGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
950221912 3:11202547-11202569 TAGGGGATGGAGGAGGGTGGGGG - Intronic
951140144 3:19148565-19148587 CAGGGGAAGTGGAAGGATGGAGG - Exonic
951147624 3:19247558-19247580 TGCAGGAAAGTGAAGGATGGAGG + Intronic
952089251 3:29864860-29864882 GAAGGGGAAGAGAAGGAGGGAGG + Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952287583 3:31982972-31982994 TAAGGAAAAGAGAAAGATGGTGG - Intronic
952310240 3:32182095-32182117 TAGGAGAGAGAGAACGAGGGGGG + Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952715540 3:36476299-36476321 GAGGGGACAGAGAAGAGTGGTGG + Intronic
952761442 3:36917962-36917984 TAGAGGAAATTGAGGGATGGAGG + Intronic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
952998706 3:38910005-38910027 AGGGGGAAGGAAAAGGATGGAGG + Intronic
954085423 3:48240360-48240382 CAGGGCAAAGAAAAGGACGGCGG + Intergenic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955252694 3:57300381-57300403 TAAGGGTAAGAGAACAATGGAGG + Intronic
955726181 3:61935197-61935219 GAGGTGAGAGACAAGGATGGGGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956068198 3:65419094-65419116 TGAGGGAAAGAGCAGGAAGGAGG - Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956938271 3:74128840-74128862 AAGGGGAAGGAGAAGAAAGGGGG + Intergenic
957042303 3:75345305-75345327 TAGGGAAAGGAGGAGGCTGGTGG - Intergenic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
957671731 3:83313592-83313614 TAGGGGGAAGAGTGGGAGGGGGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958630090 3:96673154-96673176 GAGGGGAGAGAGAGAGATGGAGG - Intergenic
958630142 3:96673594-96673616 TAGAAGAGAGAGAAAGATGGAGG - Intergenic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
958942198 3:100328923-100328945 TCGGGGAAAGAGTGGGAAGGGGG + Intergenic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
959274828 3:104265431-104265453 TGGGGGAAAGAGTTGGAGGGGGG - Intergenic
959495287 3:107043164-107043186 TAGGGCCAAGTGGAGGATGGAGG + Intergenic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
959722360 3:109506578-109506600 AAGGGGGAAGGGAAGGATAGGGG + Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
960048877 3:113222087-113222109 GAAGGGAGAGAGAATGATGGTGG - Intronic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960986643 3:123285419-123285441 TGGGTGAAAGAGAAGAGTGGTGG + Intronic
961047031 3:123716155-123716177 TAGGGAAAGGAGGAGGCTGGTGG - Intronic
962645829 3:137439090-137439112 AAAGGGAAAGAGAGGGAAGGAGG - Intergenic
962809154 3:138946884-138946906 TAGGGGAAGGGGAAGGAGAGGGG - Exonic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963833662 3:150034842-150034864 CAGGGGAAAGCTAAGGGTGGGGG + Intronic
964100176 3:152979409-152979431 AATGGGATAGAGAATGATGGAGG - Intergenic
964124333 3:153220353-153220375 GAGGGGAAAGAGAGGGATATAGG - Intergenic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964993621 3:162845898-162845920 TTGAGGAAAGACAAGGTTGGAGG - Intergenic
965111218 3:164425957-164425979 TAGGGGGAAGAGTGGGAGGGGGG - Intergenic
966059803 3:175741061-175741083 TAGGGGAAGCACAAGGATTGAGG + Intronic
966182517 3:177199631-177199653 TAGGGGAAGGAGAAGGGGTGGGG - Intergenic
966210894 3:177452415-177452437 GAGGGGAAAGAAAGGGAGGGAGG - Intergenic
966313587 3:178621475-178621497 TATCAGAAAGAGAAGGGTGGAGG - Intronic
966514377 3:180801550-180801572 TGGGGGAAAGGGTAGGAAGGGGG + Intronic
966527238 3:180932705-180932727 GAAGGGAAAGAGAAGTATGTAGG + Intronic
966583586 3:181596280-181596302 AAAGGGAGAGAGAAGGATTGAGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966906552 3:184530367-184530389 TAGGGGGAGGAGGAAGATGGAGG + Intronic
967142861 3:186576837-186576859 AAGGGGAAAGAACAGGGTGGGGG - Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
967416989 3:189230142-189230164 TGGGAAAGAGAGAAGGATGGGGG + Intronic
967511738 3:190321275-190321297 TCTTGGAAAGAGAAGGTTGGTGG - Intronic
967597052 3:191338379-191338401 TAGAAGAAAGAGAAAGATAGGGG + Intronic
967741099 3:193002963-193002985 TGTGGGGAAGAGCAGGATGGGGG - Intergenic
968593904 4:1472799-1472821 GAGGGGACAGAGACGGATTGGGG - Intergenic
969128589 4:4973770-4973792 CAGGGGAAAGAGAGAGACGGGGG - Intergenic
969392849 4:6902370-6902392 TAGGGATGAGAGGAGGATGGGGG + Intergenic
969928607 4:10609174-10609196 TGGGGAAAAGAGAAGCAGGGGGG - Intronic
969955951 4:10890781-10890803 TAGGGGCAGGAGAAGCTTGGAGG + Intergenic
970146579 4:13042381-13042403 AACGGGAAAGAGAAGGCAGGGGG + Intergenic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
972653545 4:41043815-41043837 TAAGGAAAAGAAAAGGATAGAGG - Intronic
972729352 4:41777975-41777997 AAAGGGAAAGAGAAAGGTGGTGG + Intergenic
972732225 4:41806188-41806210 GAGGGGAAGGTGATGGATGGAGG + Intergenic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
973316609 4:48767243-48767265 TAGGAGAGAGAGAGGGAAGGGGG + Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
975452254 4:74542700-74542722 TATGAGAAAGATAGGGATGGGGG - Intergenic
975967576 4:79993236-79993258 AAGGGGAGAGAAAAGGAGGGAGG + Intronic
977188502 4:93970684-93970706 AAGGGGAAAGAGAAAGATTGAGG + Intergenic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978227421 4:106353865-106353887 TAGGAGAAAGAGAACTAGGGCGG + Intergenic
978542012 4:109827238-109827260 TAGGGGAAATTAACGGATGGTGG + Intergenic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979436809 4:120702986-120703008 TGGGGGAAAGAGAAGGCTGGTGG - Intronic
979624377 4:122828298-122828320 TAGAGGAAAGAGAAAGAAAGGGG + Intronic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980121190 4:128730225-128730247 GAAGGGGAAGAGAAGGAAGGAGG - Intergenic
980250997 4:130314769-130314791 AAAGGGAGAGAGAATGATGGAGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980367832 4:131829073-131829095 TTGGGGAAAGAGAAGGAGATTGG - Intergenic
980637683 4:135529871-135529893 TGGGGGATAGAGAAGGATGCAGG + Intergenic
980720115 4:136684739-136684761 TAGGGAAAAGAGATGGAAAGGGG - Intergenic
980987607 4:139710934-139710956 TAGGGGAAAAAGAAAGAGAGTGG + Intronic
981091640 4:140738468-140738490 AAGGGGAAAGAGCAAGAAGGAGG - Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981572046 4:146162241-146162263 CAGGAGACAGAGAGGGATGGGGG - Intergenic
981579744 4:146239459-146239481 GAGAGGAAAGAGATGGGTGGAGG - Intergenic
981672998 4:147309211-147309233 TAGTGGGAAGAAAAAGATGGTGG + Intergenic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
981825335 4:148934250-148934272 TAGGGGGAAGAGTGGGAGGGTGG + Intergenic
983525495 4:168756550-168756572 TAAGGGAAAGAGAAGGATTGAGG + Intronic
983620740 4:169758315-169758337 TAGGGTAGGGAGAGGGATGGAGG - Intergenic
983967062 4:173825014-173825036 TGGGGGAAAGAGATGGCAGGTGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985093409 4:186387453-186387475 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
985674124 5:1221552-1221574 TAGGGGAAAGGGGAAGCTGGAGG + Intronic
985870404 5:2549718-2549740 TAGTTGAAAGAGAAGCTTGGTGG - Intergenic
985966761 5:3343641-3343663 GGGGGGAGAGAGAAGGGTGGGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986360657 5:6975121-6975143 TAGGAGAAAGAGAGGGAGGGAGG + Intergenic
986490907 5:8289190-8289212 AAGGAGAGAGAGAAGGAAGGAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987293889 5:16533414-16533436 TGGGAGATGGAGAAGGATGGGGG - Intronic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
987734699 5:21825547-21825569 AAGGGAAAAGAAAATGATGGGGG - Intronic
987808655 5:22804383-22804405 TGTGAGAGAGAGAAGGATGGGGG + Intronic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988237046 5:28559507-28559529 AGGGAGAAAGAGAAAGATGGGGG - Intergenic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988634129 5:32963315-32963337 TAGGAGCAAGAGAAAGAGGGAGG + Intergenic
988926110 5:35992403-35992425 AAGGGGAAAGAGAAGTGTGGAGG + Intergenic
989437490 5:41431999-41432021 TTAGGGAATGAGAAGAATGGAGG + Intronic
991522354 5:67515195-67515217 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992595319 5:78340873-78340895 CAGGGGAGAGGGAAGAATGGGGG - Intergenic
992658662 5:78936060-78936082 GAAGGGAAAGAGAGGGAGGGAGG - Intronic
992676794 5:79112854-79112876 GAAGAGAGAGAGAAGGATGGAGG + Intronic
992936049 5:81706331-81706353 GAGGGGAGAGGGAAGGATAGAGG + Intronic
992952356 5:81872855-81872877 AGAGGGAAAGAGAAGGAGGGTGG - Intergenic
993055412 5:82974788-82974810 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
993124682 5:83819080-83819102 GAAGGGAGAGAGAGGGATGGGGG - Intergenic
993168234 5:84384058-84384080 TACAGGAAAGAGGAGGACGGTGG - Intronic
993277719 5:85882901-85882923 TAGGAGAAAGAGAAACTTGGAGG + Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993884099 5:93396453-93396475 AAGGGGAAAGAGAAGTAAAGAGG - Intergenic
993894341 5:93513653-93513675 GAGGGGAGAGAGAAGGCAGGGGG + Intergenic
993945126 5:94109834-94109856 AAGGGGAGAGAGAATGATAGAGG - Intronic
994497050 5:100526046-100526068 TAGGGGAAAGGGTGGGGTGGGGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
994739569 5:103600954-103600976 TAGAGGCAAGAGAGGGTTGGAGG - Intergenic
995147441 5:108802499-108802521 GAGGGGAGAGGGAAGGACGGGGG - Intronic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995847589 5:116510701-116510723 TGGGGGAGAGAGAAGGAGGGAGG - Intronic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
996834870 5:127779879-127779901 TAGGGGAAAGGGTGGGAGGGGGG - Intergenic
997267140 5:132501427-132501449 TTGGAGAAAGAGAAGGGTGCAGG + Intergenic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
997836041 5:137194276-137194298 GAGGGGACAGAGTAGCATGGTGG + Intronic
998370190 5:141655844-141655866 GAGGGGAAAGAAAAGGCTGAGGG - Intronic
998413932 5:141931654-141931676 GGTGGGAAAGAGGAGGATGGTGG + Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998552783 5:143093734-143093756 TAGGGGAAGGGGAAGGAGAGGGG - Intronic
998624152 5:143826311-143826333 TTGGGGAAGGAGAATGTTGGGGG - Intergenic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998941358 5:147286269-147286291 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999216367 5:149938997-149939019 TGGGTGAAGGAGAAGGAAGGTGG - Intronic
999558354 5:152770671-152770693 AAAAGGAAAGGGAAGGATGGAGG + Intergenic
999744967 5:154584947-154584969 GAGGGGACAGATAGGGATGGAGG - Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000104319 5:158044415-158044437 TTGGGGAAAGGGCAGGAGGGGGG + Intergenic
1000168686 5:158679974-158679996 TAGGGGAACGAAGAGGATTGTGG - Intergenic
1000204442 5:159045354-159045376 TAGGGGAGAAAAAAGGAGGGAGG - Intronic
1000552214 5:162681104-162681126 AAGGAGAAAGAGAATGATAGGGG + Intergenic
1000815029 5:165910088-165910110 TAGGGGAAAGGAAAAGCTGGAGG + Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001108495 5:168875790-168875812 GAAGGGAAAGAGAAGGGTGGAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001558556 5:172653985-172654007 TAGGGGAAAAAAAAAGTTGGGGG - Intronic
1001844503 5:174910090-174910112 TAGGGGAAAGACAGAGATGTGGG + Intergenic
1002140007 5:177132788-177132810 AAGGGGAGGGAGAGGGATGGGGG + Intergenic
1002372317 5:178765056-178765078 AAGGGGAGAGAGAAGGAATGGGG - Intergenic
1002381331 5:178831950-178831972 GAGGGGAAAGAGCAGGTTGGGGG - Intergenic
1004279117 6:14265480-14265502 TAGGGGCAAGACACAGATGGAGG - Intergenic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004739727 6:18447129-18447151 AAGGGGAAAGAGATAGATGGGGG + Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005062087 6:21786051-21786073 TACAGGAAAGAGAATGAAGGAGG - Intergenic
1005107018 6:22234536-22234558 TGGGGGAAAGAGGACGACGGTGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005249705 6:23930482-23930504 TAAGGGAAAGTGTACGATGGTGG - Intergenic
1005579875 6:27223548-27223570 TGGGGGAGAGAGAGAGATGGAGG - Intergenic
1005845443 6:29773377-29773399 GAAGGGGAAGAGAAGGAGGGAGG - Intergenic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006268850 6:32948870-32948892 TGGGGGAGAGACAGGGATGGAGG + Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1007040440 6:38716334-38716356 GAGGGGAATGAGAAGGGTAGAGG - Intronic
1007040679 6:38719376-38719398 GAAGGGGAAGGGAAGGATGGGGG - Intronic
1007849840 6:44792479-44792501 TAGGGGAAAGAGGGTGATTGAGG + Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008101874 6:47400592-47400614 GAGGGGAGAGAGCAGGTTGGAGG - Intergenic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008498563 6:52156972-52156994 GAGTGGAGAAAGAAGGATGGAGG + Intergenic
1008521691 6:52367729-52367751 TAGAGGAAAGATGAGGATGGAGG + Intronic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1009602569 6:65821264-65821286 TAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1009828257 6:68896676-68896698 TAGGGGAAAGAGAAAGGAGTTGG + Intronic
1010732969 6:79410663-79410685 TAAGGGAGTGAGAATGATGGGGG + Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1010927249 6:81757381-81757403 TGGGGGACAGACAAGGGTGGGGG - Intergenic
1011287560 6:85741187-85741209 TGGGGGAAAGAGAGGGAGTGGGG - Intergenic
1011449968 6:87482239-87482261 TGGGGGAAAAAAAAGGAGGGGGG - Intronic
1011570133 6:88725814-88725836 TAGGGGAAGGGGAAGGAGAGGGG + Intronic
1011950443 6:92958319-92958341 GAAGGGAGAGAGAAGGAGGGAGG - Intergenic
1011977949 6:93330431-93330453 TAGGGGAGAGAGGAAGATAGAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012531533 6:100243896-100243918 CAGGAGAAAGAGAAGGGTAGGGG - Intergenic
1012809638 6:103940795-103940817 TAAAGGAAAGAGAAAAATGGGGG + Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013231339 6:108164667-108164689 CCGGGGAAAGAGCAAGATGGGGG - Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013362312 6:109405400-109405422 TAAGGAAAAGAAAGGGATGGAGG - Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014337319 6:120153010-120153032 TAGGGGGAAGAGTGTGATGGTGG + Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015184550 6:130399831-130399853 TAAGGGGAAGAGTAGGAGGGGGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1016196965 6:141355857-141355879 TAGGGGAAAGAGTGGGAGGCAGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016514442 6:144878850-144878872 TAGGGGGAGGAGAAGGAAAGTGG - Intergenic
1017472257 6:154750451-154750473 TGGGGGAAAGGGAGGGAGGGAGG - Intronic
1017484810 6:154892681-154892703 CAGGGGAAAAGAAAGGATGGGGG - Intronic
1017772341 6:157652910-157652932 AAGGGGAGAGAGGAGGAAGGGGG + Intronic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018191610 6:161314360-161314382 TAGGGGAAGGGGAAGGAGAGGGG - Intergenic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019619031 7:1980543-1980565 TAGGAGAAAGCAAAGGATAGAGG + Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020215417 7:6186505-6186527 TTGAGGAAAGAGAAAGATGCTGG + Intronic
1020877251 7:13713484-13713506 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1020877258 7:13713500-13713522 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021121113 7:16796830-16796852 TGGGGGACAGAGAAGGAAGTGGG + Intronic
1021134120 7:16944859-16944881 AAGGGGAAAGAGCAGGCAGGAGG + Intergenic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1022114518 7:27250328-27250350 TAGAGGAAAGAGTAGGAGTGGGG + Intergenic
1022715755 7:32896530-32896552 AAGAAGAAAGAGAAGGCTGGAGG + Intergenic
1022953385 7:35360021-35360043 TGGGGGAAAGAGTGGGAAGGGGG - Intergenic
1023370185 7:39505496-39505518 GGGGGGAAAGAGAGGGAGGGAGG - Intergenic
1023562841 7:41493710-41493732 TAAGGGAAAGAGAAAGAGAGAGG + Intergenic
1023863014 7:44226845-44226867 TAGGGGAAAGAAGGGGATGTGGG + Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024741287 7:52357833-52357855 TTGTGGAAAGAAAATGATGGTGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1026097647 7:67359183-67359205 CAGGGGAAAGAGAAGGGCTGGGG - Intergenic
1026103239 7:67399868-67399890 TCGGGGAAAGAGTGGGAAGGGGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026497298 7:70914249-70914271 GAGGGGAAAGGGAAGGGAGGGGG - Intergenic
1026650020 7:72209025-72209047 AAGGAGAGAGAGAAGGAAGGAGG - Intronic
1027175267 7:75899290-75899312 ATGGGGACAGAGCAGGATGGGGG + Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028713689 7:93939887-93939909 TAAGGGAAAGGGAGAGATGGAGG - Intergenic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1028752228 7:94394408-94394430 GAGGGGGCAGAGAAGGAGGGAGG - Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029805447 7:102991300-102991322 TGGGGGAAAAGGAAGGTTGGAGG + Intronic
1030123463 7:106133283-106133305 TAGGGGAAAGTGAGGCAAGGAGG + Intergenic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031232007 7:119119821-119119843 TAGGGGAAAGGGTGGGAGGGTGG - Intergenic
1031264521 7:119566809-119566831 GAGGGGAGAGAGAGAGATGGAGG + Intergenic
1032057446 7:128695213-128695235 TGGGGCAGAGAGCAGGATGGTGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1033062046 7:138118838-138118860 GAGGGGAAAGAAAAAGAAGGAGG + Intergenic
1033310420 7:140257671-140257693 TCAGGGAAAGAGTAGGAAGGGGG + Intergenic
1033366911 7:140678790-140678812 TAATGGAAAGAGAGGGCTGGGGG + Intronic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034409396 7:150931839-150931861 CAGGGGAGAGAAAAGGATGCTGG + Intergenic
1034878918 7:154749067-154749089 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034878925 7:154749119-154749141 GACCGGAAAGAGAAGGATGGCGG + Intronic
1034878971 7:154749327-154749349 GATGGGAGAGAGAGGGATGGAGG + Intronic
1034878999 7:154749481-154749503 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879008 7:154749533-154749555 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879018 7:154749585-154749607 GACGGGAGAGAGAGGGATGGAGG + Intronic
1034879035 7:154749688-154749710 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879044 7:154749740-154749762 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879053 7:154749792-154749814 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879071 7:154749895-154749917 GATGGGAAAGAGAGGGATGGAGG + Intronic
1034879080 7:154749947-154749969 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034879089 7:154749999-154750021 GACGGGAAAGAGAGGGATGGAGG + Intronic
1034911309 7:155001327-155001349 GAGGGGGAAGAGAAAAATGGTGG + Intronic
1035089352 7:156293941-156293963 TAGGGGAAAACAAAGAATGGTGG - Intergenic
1035197915 7:157238533-157238555 TATGAGAACTAGAAGGATGGAGG + Intronic
1035441474 7:158905056-158905078 TAGGGGGAAGAGGTGGATTGAGG + Intronic
1035763688 8:2088198-2088220 TGGGGGAAAGAGTGGGAGGGAGG - Intronic
1035830599 8:2690720-2690742 TTGAGGAAAGAGAGAGATGGTGG + Intergenic
1036188836 8:6650833-6650855 GAGGAGAGAGAGAAGGAAGGAGG - Intergenic
1036229884 8:6990682-6990704 TAGGAGAAGGAGGAGGACGGTGG - Intergenic
1036232335 8:7009785-7009807 TAGGAGAAGGAGGAGGACGGTGG - Intronic
1036603304 8:10283585-10283607 AGGGGGAAAGAGGAGGAAGGGGG - Intronic
1036725287 8:11215151-11215173 TTGGGGAACAAGAAGGTTGGTGG - Intergenic
1037548274 8:19944959-19944981 AAGGGGAAGGGGAAGGAAGGAGG - Intronic
1037652533 8:20851900-20851922 TAGGGGAAAGGGGAAGATGGAGG + Intergenic
1038132314 8:24746118-24746140 TAGGAGAAAGAACAGGATGAAGG - Intergenic
1038251039 8:25904433-25904455 TGGGGGTAAGGGAAGGAGGGGGG + Intronic
1038356269 8:26832045-26832067 GAGGGGGAAGAGAAGGCTGGTGG - Intronic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038433920 8:27521472-27521494 TGGAGGACAGAGAAGGATGATGG + Intronic
1038463529 8:27738108-27738130 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1039277842 8:35952939-35952961 TTGGTGAAAGAGTAGGGTGGGGG - Intergenic
1039338279 8:36619049-36619071 GAGGGGAAGGGGAAGGATGGGGG + Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040073487 8:43206755-43206777 TAGGGGAATGACAGAGATGGGGG - Intergenic
1041059416 8:54021973-54021995 GAGGGGAGGGAGAAGGAGGGAGG + Intronic
1041411412 8:57560521-57560543 AAGGAGAAAGAGAAGGGAGGAGG - Intergenic
1041769702 8:61459496-61459518 TGGGGGGAAGAGTAGGAGGGGGG - Intronic
1042089149 8:65139744-65139766 TGGGGGAAAGAGTGGGAGGGGGG + Intergenic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042368249 8:67960636-67960658 TAGGGGAGAGGCAAGTATGGAGG + Intronic
1042628718 8:70791593-70791615 TGGGGGAAAGAGAAAGAAAGAGG - Intergenic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1043369123 8:79570869-79570891 TAGGGTAAAGAAATGTATGGAGG - Intergenic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1043887891 8:85623483-85623505 AGGGAGAAAGGGAAGGATGGAGG - Intergenic
1044600344 8:93997454-93997476 TAGGGGATAGTAAAGAATGGGGG + Intergenic
1044802999 8:95976262-95976284 AAGGAGAGAGAGAAGGATGGAGG + Intergenic
1044860189 8:96515453-96515475 TATGGGAAATAGAAGGATGGAGG + Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044935567 8:97290446-97290468 GTGGGGAAAGACAGGGATGGGGG + Intergenic
1045458002 8:102400891-102400913 AAGGGGAAAAGGAAGGTTGGAGG + Intronic
1045957031 8:107920115-107920137 TAGGAGGAAGAGAAAGAAGGAGG + Intronic
1046478249 8:114778368-114778390 GAGGGGAGAAGGAAGGATGGGGG + Intergenic
1046573549 8:115996882-115996904 TAAGGGGAAGAGAATGCTGGAGG + Intergenic
1046920480 8:119722884-119722906 GAGGAAAAAGAGAGGGATGGAGG + Intergenic
1047186245 8:122635963-122635985 TAAGGGAAAAAGAAAGAGGGAGG + Intergenic
1047207155 8:122811700-122811722 AGGGGGGAAGAGAAGGAAGGTGG + Intronic
1047255807 8:123212690-123212712 CAGGGGAAAGAGAATGGTGCTGG + Intergenic
1047632303 8:126721632-126721654 TGGGGAAAAAAGATGGATGGTGG - Intergenic
1047689179 8:127333460-127333482 TATGGGAAACAAAAGGATAGAGG + Intergenic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1048062260 8:130932475-130932497 TGGGGAAAAGAGAAGGAAGTGGG - Intronic
1048107814 8:131430496-131430518 TGGGGGAAAGAGTTGGAAGGAGG + Intergenic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049684361 8:143933463-143933485 AAGGGGAAGGACAGGGATGGAGG - Intronic
1049736667 8:144211024-144211046 TAAGAGAAAGAGAAGAACGGAGG - Intronic
1050477380 9:6054169-6054191 AAGGGGAAAGAGAACTCTGGAGG + Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051159787 9:14194269-14194291 TTGGGGAAAGTAAAGGGTGGTGG - Intronic
1051235267 9:14992885-14992907 TAGGGGAGGGAGAGGGATGGAGG + Intergenic
1051385016 9:16498511-16498533 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
1051397145 9:16635885-16635907 TATGGCAAAGGGTAGGATGGTGG + Intronic
1051486852 9:17617976-17617998 TAGGGGATAGAAATGGGTGGAGG + Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051903511 9:22068432-22068454 TAGGGGAAATTGAAGGATCAGGG + Intergenic
1051919928 9:22252555-22252577 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052350520 9:27454003-27454025 TAGGAGAGAGAGAAGTATGAGGG + Intronic
1052833822 9:33235817-33235839 CAGGGGGAAGACACGGATGGAGG + Intronic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053437448 9:38085857-38085879 TATGGGACAGATAAGGATGAGGG - Intergenic
1053469286 9:38334500-38334522 TAGGGGAAACAGAATGAAAGAGG - Intergenic
1053475474 9:38379164-38379186 TGGGAGAGAGAGAAGGAAGGGGG + Intergenic
1053567731 9:39270764-39270786 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1053833742 9:42111711-42111733 TAGAGGGAAGATAAGGGTGGGGG - Intronic
1054129412 9:61348235-61348257 TAGAGGGAAGATAAGGGTGGGGG + Intergenic
1054732719 9:68717082-68717104 AAGGGGACAGGGAAGGAGGGAGG + Intronic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056381729 9:86062538-86062560 AAGAGGACAGAGTAGGATGGAGG + Intronic
1056414564 9:86364011-86364033 TGGGGAAAAAAAAAGGATGGGGG - Intergenic
1056703104 9:88927047-88927069 AAGGGGAGAGAGAGAGATGGGGG + Intergenic
1056801204 9:89693256-89693278 TAGAGGAATGAAATGGATGGTGG + Intergenic
1057115969 9:92522498-92522520 ATGGGGAAAGAGAAGGAGAGAGG - Intronic
1057131534 9:92657584-92657606 AAGGGGACAGAGAAGGCTGGAGG + Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058740108 9:107934465-107934487 TAGGAGAAAGAAAGAGATGGGGG - Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058810333 9:108632933-108632955 TTAGGGGATGAGAAGGATGGAGG + Intergenic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1059499773 9:114741643-114741665 TAGGGGGAAGAGTGGGAAGGGGG + Intergenic
1059806404 9:117805791-117805813 TAAGGGAAGGAGAGGGAGGGAGG - Intergenic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060185294 9:121560425-121560447 GAGGGGAAAGAGATGGGAGGAGG + Intergenic
1060307940 9:122433306-122433328 CTTGGGAAAGAGAAGGTTGGTGG - Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061146713 9:128803934-128803956 TCTGGGAGAGAGCAGGATGGGGG - Exonic
1061869886 9:133515038-133515060 TAGGAGGGAGAGAAGGATGGAGG - Intronic
1061942784 9:133892083-133892105 AGGGGGAAGGAGAGGGATGGGGG + Intronic
1062080784 9:134622385-134622407 AAGGAGGGAGAGAAGGATGGAGG - Intergenic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062504342 9:136865709-136865731 TAGGGGACAGAGAACCAGGGTGG - Intronic
1185469730 X:375156-375178 TAAGGAAGTGAGAAGGATGGAGG - Intronic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185818855 X:3182532-3182554 TAAGGAAAAAAAAAGGATGGGGG + Intergenic
1185933296 X:4227477-4227499 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186149584 X:6660257-6660279 AACGGGAAAGAGAAGAATGTTGG + Intergenic
1186238523 X:7541104-7541126 TGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1186579569 X:10803024-10803046 TAGGGGAGAGAGAGGGATGGGGG + Intronic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187856549 X:23642105-23642127 TAGGGGAAAGGGGATGATGTTGG + Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188376894 X:29442346-29442368 TGGGGGAAAGAGTGGGAGGGGGG + Intronic
1188460791 X:30424973-30424995 TAGGGTAAAGAGAAAAATTGAGG - Intergenic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188819311 X:34754125-34754147 AAGGAGAAAGAGAGTGATGGAGG + Intergenic
1189378712 X:40486193-40486215 AAAGGGAAAGGGAAGGAAGGAGG - Intergenic
1189962682 X:46339461-46339483 TGGGGGAAAGAGTGAGATGGGGG + Intergenic
1190066672 X:47246089-47246111 GAGGGGATGGAGAGGGATGGTGG - Intronic
1190508503 X:51153478-51153500 TAGGTGAAAGAGTGGGAGGGTGG - Intergenic
1190553606 X:51611573-51611595 GAGAGGAAAGAGAAAGAAGGAGG - Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1191001185 X:55661169-55661191 CAGGGGAAAGGGTGGGATGGGGG + Intergenic
1191599891 X:62991258-62991280 AAGGGGGAAGAGAAGGATCTAGG - Intergenic
1191890128 X:65931565-65931587 TAGGGGAAGGGGAAGGAGAGTGG - Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192159337 X:68771251-68771273 TAGGGGACAGAGATTGGTGGTGG - Intergenic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1192405520 X:70882070-70882092 TATGGGAAAAAGAAAGATAGAGG - Intronic
1192783790 X:74318972-74318994 TCGGGGAAAGAGAAGGGAGGTGG + Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193331947 X:80244773-80244795 AGAGGGAGAGAGAAGGATGGAGG - Intergenic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1193641623 X:84015662-84015684 AAGGGGAAAGGGAAGGATATTGG - Intergenic
1193709804 X:84865586-84865608 TGGGGGTGAGAGGAGGATGGAGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1193972297 X:88069447-88069469 GAGGGGAAAGAAAAGCAAGGAGG + Intergenic
1194077222 X:89411154-89411176 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194275531 X:91876208-91876230 TCGGGGAAAGAGAAGGAAGGTGG + Intronic
1194510961 X:94794159-94794181 TAGGGGAAAGTGTGGGAAGGGGG - Intergenic
1195231444 X:102853364-102853386 TCGGGGAAAGGGTAGGAAGGAGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195518545 X:105805005-105805027 AAGGGGAAAGAGAAGAGAGGAGG + Intergenic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1196197450 X:112851108-112851130 TAATGGAAAGATAAGGACGGTGG - Intergenic
1196327913 X:114429776-114429798 TGGGGGAAATAGACGGATGTTGG + Intergenic
1196663549 X:118293640-118293662 TAGGGGTTGCAGAAGGATGGAGG + Intergenic
1196834486 X:119801906-119801928 GGAGGGAAAGAGAAGGAGGGAGG - Intergenic
1196874360 X:120144180-120144202 TAGGGGAAGGGGAAGGAGAGGGG + Intergenic
1196944332 X:120809022-120809044 TGGGGGAAAGGGAGGGATGGGGG + Intergenic
1197070311 X:122288957-122288979 TAGGGGGAAGAGTGGGAAGGAGG + Intergenic
1197251305 X:124218747-124218769 TTGGGGAAAGAGAGGGACTGTGG - Intronic
1197548560 X:127858933-127858955 GAGGGGGAAGGGAAGAATGGGGG + Intergenic
1197765305 X:130056186-130056208 TCGGGGAAAGACAAGGAGGTGGG - Exonic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199024537 X:142920877-142920899 TATGGGAAATAGCATGATGGTGG - Intergenic
1199080208 X:143568358-143568380 TAGGGGCAAGTGAAAGATAGAGG - Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199695735 X:150341705-150341727 AAAGGGAAAGAGAGGGAGGGGGG - Intergenic
1199713441 X:150488838-150488860 TGAGGGAGAGAGAAGTATGGTGG + Intronic
1199858587 X:151779902-151779924 TGGGGGAGAGAGAAGAATTGAGG - Intergenic
1200153832 X:153964767-153964789 TTGGGGAATGAGAGGAATGGGGG - Intronic
1200429868 Y:3066699-3066721 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1200763494 Y:7061607-7061629 TAGGGGAAGGAGAAGGAGAGGGG - Intronic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201236407 Y:11916122-11916144 AAAGAGAAAGAGAAGGCTGGAGG - Intergenic
1201253902 Y:12088419-12088441 AAGGGGAGAGAGAAGAATGGAGG - Intergenic
1201269571 Y:12241919-12241941 TGGGGGAAAGGGTAGGAAGGGGG - Intergenic
1201475491 Y:14376851-14376873 AAGGAGGAAGAGAAGAATGGAGG + Intergenic
1201760083 Y:17527427-17527449 GTGGGGGAAGAGAAGGATAGTGG - Intergenic
1201841471 Y:18378563-18378585 GTGGGGGAAGAGAAGGATAGTGG + Intergenic
1202087405 Y:21153465-21153487 TAAGGAGAAGAAAAGGATGGAGG + Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic