ID: 1014818748

View in Genome Browser
Species Human (GRCh38)
Location 6:125961921-125961943
Sequence CAGAATCCCTTCAGAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014818744_1014818748 -3 Left 1014818744 6:125961901-125961923 CCTTCCTCCAGGGTATGAGGCAG 0: 3
1: 16
2: 74
3: 164
4: 657
Right 1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG No data
1014818740_1014818748 14 Left 1014818740 6:125961884-125961906 CCTCTCTGTGAAGCTTTCCTTCC 0: 1
1: 7
2: 69
3: 232
4: 605
Right 1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG No data
1014818745_1014818748 -7 Left 1014818745 6:125961905-125961927 CCTCCAGGGTATGAGGCAGAATC 0: 1
1: 3
2: 13
3: 48
4: 246
Right 1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG No data
1014818746_1014818748 -10 Left 1014818746 6:125961908-125961930 CCAGGGTATGAGGCAGAATCCCT 0: 1
1: 1
2: 8
3: 35
4: 229
Right 1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG No data
1014818739_1014818748 29 Left 1014818739 6:125961869-125961891 CCAGATTCTTCTTGGCCTCTCTG 0: 18
1: 35
2: 58
3: 62
4: 425
Right 1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014818748 Original CRISPR CAGAATCCCTTCAGAAATGA GGG Intronic
No off target data available for this crispr