ID: 1014818866

View in Genome Browser
Species Human (GRCh38)
Location 6:125963261-125963283
Sequence TAAGGTATTCAAAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014818860_1014818866 -8 Left 1014818860 6:125963246-125963268 CCGTGAAGCTAGTGATAAGGTAT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG No data
1014818857_1014818866 27 Left 1014818857 6:125963211-125963233 CCAACAAAAAATAGATGTCTTGC 0: 1
1: 0
2: 2
3: 11
4: 214
Right 1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG No data
1014818856_1014818866 28 Left 1014818856 6:125963210-125963232 CCCAACAAAAAATAGATGTCTTG 0: 1
1: 0
2: 2
3: 32
4: 319
Right 1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG No data
1014818858_1014818866 5 Left 1014818858 6:125963233-125963255 CCATTCTTGACATCCGTGAAGCT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014818866 Original CRISPR TAAGGTATTCAAAAGGGGGA GGG Intronic
No off target data available for this crispr