ID: 1014820811

View in Genome Browser
Species Human (GRCh38)
Location 6:125986696-125986718
Sequence CTGCATAGCCCGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014820802_1014820811 23 Left 1014820802 6:125986650-125986672 CCGACGGAAGAGGACGCTGGAGT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014820811 Original CRISPR CTGCATAGCCCGAGGAAGCT GGG Intronic
900671529 1:3857640-3857662 CTGCGCAGCCCGAGGAAGTTCGG + Exonic
901219752 1:7576792-7576814 GTGCATGGCCCCAGGAAGGTCGG + Intronic
904626665 1:31809950-31809972 CTGCATTGCAAGAGGCAGCTTGG - Intronic
905456971 1:38094965-38094987 CTGCATCCCCAGAGGAGGCTGGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906653883 1:47533768-47533790 CTGCAGAGCCCTAGGAACCCGGG + Intergenic
907978658 1:59459122-59459144 CTGCATGGGCCCAGGAAGCCTGG - Intronic
909342599 1:74548451-74548473 CTGCATAGCCCTGGGAAGAGGGG + Intergenic
910708790 1:90157273-90157295 CTGCCCACCCCCAGGAAGCTGGG - Intergenic
911635914 1:100236212-100236234 CTCCATCTCCTGAGGAAGCTGGG + Intronic
915677727 1:157547264-157547286 CTGCATAGCCTGAAGGACCTGGG + Intronic
920062415 1:203236607-203236629 ATGCATAGTGCGAGGAAGATGGG - Intronic
920260588 1:204685436-204685458 CTGCACAGGCCGGGGAGGCTCGG + Intronic
920871443 1:209798398-209798420 CTTCATAGCCCGAGTCAGCTGGG - Intronic
922857885 1:228790612-228790634 CTGCATGGCTGGAGAAAGCTGGG + Intergenic
1063462797 10:6225253-6225275 CTGTCTAGTCCCAGGAAGCTTGG + Intronic
1065881556 10:30041703-30041725 CTGCATAGCCCCAGGAATTCTGG - Intronic
1067484470 10:46634884-46634906 CTGCAAAGCCCGAGGACACTGGG - Intergenic
1067610290 10:47706764-47706786 CTGCAAAGCCCGAGGACACTGGG + Intergenic
1067804295 10:49382456-49382478 CTGCATCCCCAGAGGTAGCTGGG - Intronic
1068794624 10:61065168-61065190 CTGGATAGCCTGAAGAATCTAGG + Intergenic
1071411619 10:85402583-85402605 CTTCATAGCCTGGGGAACCTTGG - Intergenic
1075823536 10:125334353-125334375 CTGCATAACCCCAGGAAGCCTGG + Intergenic
1077250884 11:1560179-1560201 GTGCAGAGCCTGAGGCAGCTGGG + Intronic
1077888954 11:6405194-6405216 CTGCAGGGCCCCAGGCAGCTGGG - Intronic
1080384007 11:31799893-31799915 CTCCACACCCCGAGGTAGCTTGG - Intronic
1083424560 11:62576355-62576377 CAGCAGAGTCCCAGGAAGCTAGG + Intronic
1085809497 11:79667502-79667524 CTGCATTGCTCGAGGAAGGTAGG - Intergenic
1088750898 11:112841438-112841460 TTGCATAGGCTGAGGAAGCCTGG - Intergenic
1090588087 11:128236039-128236061 CTACTTAGGCCGAGGAAGCCTGG - Intergenic
1091001680 11:131915243-131915265 CTGAATAGTCCTGGGAAGCTTGG - Intronic
1091006184 11:131955887-131955909 CTGCTTTGCCCCAGGAATCTTGG - Intronic
1091826403 12:3516031-3516053 CTCCAGAGCCCAAGAAAGCTGGG - Intronic
1096568871 12:52507135-52507157 CAGCATAGCTGGAGGGAGCTGGG + Intergenic
1098979812 12:76944324-76944346 CTGCATAATCCCAGGTAGCTAGG - Intergenic
1103612469 12:122132376-122132398 CTGCACAGGTAGAGGAAGCTGGG + Exonic
1103728883 12:123013040-123013062 CTGCCAAGCAGGAGGAAGCTGGG + Intronic
1105869529 13:24491927-24491949 CTGCAGATCACGAGGAAGCCAGG + Intronic
1113768792 13:112895800-112895822 CTGCACAGCCCGGTGAAGTTGGG - Intronic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1124207077 15:27730309-27730331 CTGCAGAGGCCAGGGAAGCTCGG - Intergenic
1125313523 15:38406506-38406528 CTGCATGACTCGAGGATGCTGGG - Intergenic
1127994258 15:64143614-64143636 CTGTGTGGCCCGAGGAGGCTGGG + Intronic
1137557750 16:49483515-49483537 CTGCATCACCCGAGCAAGCACGG - Intergenic
1138588096 16:57984789-57984811 CTGCCTTGCCTGAGGAAGCGAGG + Exonic
1139528014 16:67528542-67528564 CTCCAGAGCCCGAGGGATCTGGG + Intronic
1139701758 16:68711963-68711985 CTGCATGATCCTAGGAAGCTAGG + Intronic
1140855242 16:78972120-78972142 CTGCATTGGAGGAGGAAGCTTGG + Intronic
1141210384 16:81973879-81973901 CTGCTTAGCCCCAGGAAGAGGGG - Intergenic
1141519333 16:84567214-84567236 GGGGATGGCCCGAGGAAGCTGGG + Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1145941043 17:28743659-28743681 CTGCCTAGCACCTGGAAGCTGGG + Intergenic
1147578933 17:41617808-41617830 CTGAATAGTCCCAGGAAGCAGGG - Intergenic
1158402949 18:57137613-57137635 ATGCATAGCCTGAGTAAGCTTGG + Intergenic
1160929412 19:1563123-1563145 CTGCAGAGCCCTAGGAAGAAAGG - Intronic
1163712638 19:18855878-18855900 GTGCTTACCCAGAGGAAGCTCGG - Intronic
1163915038 19:20233786-20233808 CTGCAGAGCCCTGGAAAGCTGGG - Intergenic
1165931860 19:39364273-39364295 CAGCATAGCCAGAGGCATCTGGG - Intronic
1166996822 19:46723360-46723382 CTGCCAAGCCCCAGGCAGCTGGG + Intronic
925186417 2:1849670-1849692 CTGCAGAGGCTGAGGAATCTGGG + Intronic
940331589 2:152480717-152480739 CTGCATAGCCCTTGGTAGATGGG - Intronic
1170221424 20:13946590-13946612 CCGCAGAGCCAGTGGAAGCTGGG + Intronic
1170551117 20:17477121-17477143 CTGCATTGCCCTAGGAACCAAGG - Intronic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1172696940 20:36829450-36829472 CAGCACAGCCCCAGAAAGCTGGG + Intronic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
1185413250 22:50697012-50697034 CTGCCAAGCCCGAGGGAGCCTGG + Intergenic
949192012 3:1261438-1261460 CAGCATAGGCCAAGGAAACTGGG + Intronic
949911102 3:8908518-8908540 CTGCATGGCCCTGAGAAGCTCGG + Intronic
950690513 3:14652223-14652245 CTGCATAGCAAAAAGAAGCTAGG - Intronic
958762216 3:98322870-98322892 CTGCATAGCTCTTGGGAGCTAGG - Intergenic
961735225 3:128997189-128997211 CTACATAGCCTGTGGGAGCTTGG - Intronic
964645051 3:158949943-158949965 GTGAATAGGCTGAGGAAGCTTGG + Intergenic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
968285230 3:197504724-197504746 CTGCATGGCCAGAGGAGGCGGGG + Intergenic
981600318 4:146481162-146481184 CTGCTTAGCCCCAGAAAGCATGG - Intronic
981783980 4:148456980-148457002 CTGAACAGCCCATGGAAGCTGGG - Intergenic
982127009 4:152192868-152192890 CGGAACAGTCCGAGGAAGCTGGG - Intergenic
983242093 4:165245513-165245535 CTGCATTCCCGTAGGAAGCTGGG + Intronic
990387716 5:55283596-55283618 CTGAAGATCCCGAGGAATCTTGG - Exonic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
997397650 5:133577263-133577285 CTGCATAACTGGAGGAAGCAGGG - Intronic
999743416 5:154574073-154574095 TTGCAGAGCCCGGGGATGCTGGG - Intergenic
1000328257 5:160188300-160188322 CTTCAGAGCTCTAGGAAGCTGGG + Intronic
1006116567 6:31779008-31779030 CAGGATAGCCCGAGGCAGCACGG + Exonic
1006365326 6:33611698-33611720 CTGGATAGGAGGAGGAAGCTGGG - Intergenic
1006659906 6:35632272-35632294 TTGCTTAGCCCCAGGAAGTTGGG - Intronic
1007054711 6:38870913-38870935 GTGCAGAGCCTGAGGAATCTGGG + Intronic
1007777308 6:44230892-44230914 CCGAAGAGCCTGAGGAAGCTGGG + Intronic
1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG + Intronic
1015891370 6:137972962-137972984 CTGCATAGCCCCAGGAAAGGTGG + Intergenic
1023848644 7:44138531-44138553 CTGCACAGCCCCAAGTAGCTGGG + Intergenic
1025767323 7:64467773-64467795 CTACAGAGCCCTAGAAAGCTGGG + Intergenic
1028868480 7:95738975-95738997 CTGCTCAGCCCCAGGAAGGTAGG - Intergenic
1030375188 7:108745799-108745821 CTGGAGAGCCCGAGGCAACTGGG - Intergenic
1034503422 7:151467091-151467113 CTGCAAAGCCTGAGGACACTGGG - Exonic
1035193029 7:157189159-157189181 CTGAATATGCCGAGGAAGCTGGG + Intronic
1037594937 8:20347014-20347036 CTGCAAAGCCCGAGTGGGCTGGG - Intergenic
1041583942 8:59494862-59494884 CTGCATAGCCCACTGCAGCTTGG - Intergenic
1045239259 8:100384602-100384624 CTGCAGAGCCTGGGGAAGCCTGG - Intronic
1047928345 8:129702456-129702478 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1047928362 8:129702613-129702635 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1047928376 8:129702737-129702759 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1052758615 9:32567068-32567090 CTGTGCAGCCCGAGGAAGTTTGG - Exonic
1056066267 9:82938506-82938528 CTGCATAGCTGGAGAAAGTTTGG - Intergenic
1062123267 9:134845735-134845757 CAGCATTGCCCAGGGAAGCTGGG + Intergenic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1188709611 X:33379220-33379242 CTGCATAGCTCTAGGTTGCTGGG - Intergenic
1188756390 X:33968924-33968946 CTGCAGAGCCAGTGGGAGCTGGG + Intergenic
1192845169 X:74899762-74899784 CTGAATAGCCAGAGTAATCTTGG + Intronic
1196047064 X:111267533-111267555 CTGGAAAGCTTGAGGAAGCTAGG + Intronic
1198102316 X:133432747-133432769 CGGCAAACCCCGTGGAAGCTGGG - Intergenic