ID: 1014824527

View in Genome Browser
Species Human (GRCh38)
Location 6:126033729-126033751
Sequence CAGCAGACCATGCATCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014824527_1014824528 6 Left 1014824527 6:126033729-126033751 CCTGGCAGATGCATGGTCTGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1014824528 6:126033758-126033780 AAGCTATTTCAGTTCACATCAGG 0: 1
1: 0
2: 1
3: 9
4: 126
1014824527_1014824529 23 Left 1014824527 6:126033729-126033751 CCTGGCAGATGCATGGTCTGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1014824529 6:126033775-126033797 ATCAGGAAGTACTCTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014824527 Original CRISPR CAGCAGACCATGCATCTGCC AGG (reversed) Intronic
900358893 1:2278566-2278588 CACCACACAATGAATCTGCCGGG - Intronic
900680578 1:3914206-3914228 CAGCAGTGAATGCAGCTGCCTGG + Intergenic
902931671 1:19735823-19735845 CAGCAAACCGTCTATCTGCCAGG - Intronic
903221084 1:21870059-21870081 GAGCAGACCAGGCATCAGGCTGG + Intronic
907162641 1:52382494-52382516 GGGCAGACATTGCATCTGCCTGG + Intronic
907660148 1:56384264-56384286 CAGTAGGCCCTGCATCTGCAAGG - Intergenic
911217008 1:95205902-95205924 CACCAGACAGTGAATCTGCCAGG - Intronic
912379844 1:109241390-109241412 CAGCTCCCCATCCATCTGCCAGG + Intergenic
912679049 1:111717076-111717098 GAGCAGCCCATGCAACTGCCTGG + Intronic
915241097 1:154522407-154522429 AAGCAGAGCATGCATATGGCTGG + Intronic
917155724 1:171996523-171996545 CATCAGACCATTCCTCTGCTAGG + Intronic
923685011 1:236147714-236147736 CAGCTCAGCAAGCATCTGCCCGG + Intronic
1063320272 10:5045783-5045805 CTGCAGTCCATGCACCAGCCTGG - Intronic
1063552225 10:7044204-7044226 CAAGTGACCAGGCATCTGCCCGG + Intergenic
1066338858 10:34509220-34509242 GAGCAGAACATGCATCTACCTGG + Intronic
1067569341 10:47360183-47360205 CAACAAGCCATGCCTCTGCCAGG + Intergenic
1070160679 10:73865145-73865167 TTGCAGACCCTGCATCTGCCTGG - Intronic
1070212284 10:74337358-74337380 CAGAAGACATTGCACCTGCCTGG + Intronic
1070735553 10:78861515-78861537 AAGAGCACCATGCATCTGCCCGG + Intergenic
1071474361 10:86012791-86012813 CAGCAGACGCTGAATCTGCTGGG + Intronic
1073326968 10:102648750-102648772 CAGCAGACCATACTCCTGCAGGG + Intronic
1075754375 10:124799465-124799487 CAGTAAACCATGCAGCTGCCTGG + Intergenic
1076162137 10:128253097-128253119 CAGCAGTCAAAGCATGTGCCTGG - Intergenic
1076307590 10:129475951-129475973 CAGCTGACCAACCATTTGCCAGG + Intronic
1076307962 10:129478060-129478082 CAGCAGACCATGGAAAGGCCTGG + Intronic
1076470226 10:130713599-130713621 AAGCAGACCTTGTATCTGCTCGG - Intergenic
1076744774 10:132507370-132507392 CCACCCACCATGCATCTGCCTGG + Intergenic
1076753965 10:132558405-132558427 CAACACACCATGCAGCTGTCAGG - Intronic
1077210922 11:1370606-1370628 CAGCAGTCCCTGCATGTGTCGGG + Intergenic
1077509068 11:2946170-2946192 CAGAAGAGGATGGATCTGCCGGG - Intronic
1077736447 11:4796750-4796772 CAGGAGACCTGGCATCTCCCAGG - Intronic
1077800751 11:5533546-5533568 TAGCAGATCATCAATCTGCCTGG - Intronic
1084278944 11:68073733-68073755 CAGCAGAGCACCCCTCTGCCAGG + Intronic
1085099442 11:73788132-73788154 CAGCAGCACATGCGGCTGCCTGG + Intronic
1089892777 11:121898046-121898068 CAGCAGCACATCCATGTGCCAGG + Intergenic
1090959857 11:131546646-131546668 CAGCAGCCTCTGCAGCTGCCTGG + Intronic
1091047167 11:132334970-132334992 CAGCAGACCAGGCAACCACCGGG + Intronic
1095880402 12:47129768-47129790 GAGGAGACCATGCGTCTGGCAGG + Intronic
1095943781 12:47742095-47742117 CATCAGATCATCCATGTGCCTGG + Intronic
1096590441 12:52655454-52655476 CAGCAGCCCATGCAGAGGCCAGG - Intergenic
1103845759 12:123901085-123901107 CTCCAGCCCATGCTTCTGCCTGG + Intronic
1104105774 12:125657632-125657654 CTGGGGACCATGCATTTGCCTGG + Exonic
1108766529 13:53637383-53637405 AAGCAGACAATTCAACTGCCAGG - Intergenic
1109253729 13:60052020-60052042 CAGCACAGCATGCATCTGGGAGG - Intronic
1109931766 13:69225523-69225545 CTGCAGGCAATGCTTCTGCCAGG + Intergenic
1110519638 13:76459988-76460010 CTGCAAACCATTAATCTGCCTGG + Intergenic
1112102364 13:96203258-96203280 CACCAGACATTGCATCTACCTGG - Intronic
1113098420 13:106690865-106690887 CAGCAGCCCATGGCTCTGACGGG + Intergenic
1113501225 13:110775966-110775988 CAGCAGAGCAAGCTCCTGCCTGG + Intergenic
1117074908 14:52092523-52092545 CAGCAAACCATGATTATGCCTGG - Intergenic
1120955632 14:90079549-90079571 CAGCAGAGCCTGCAACTGCTGGG + Intronic
1121242917 14:92442837-92442859 CTTCAGGGCATGCATCTGCCGGG - Intronic
1122144752 14:99682966-99682988 CAGCAGAGCATCCATCCCCCCGG - Intergenic
1123643946 15:22423948-22423970 CAGCAGCCCATGCCTTCGCCTGG + Intergenic
1123707325 15:22959710-22959732 CAACAGACCGTGTATCTGCTGGG + Intronic
1123734365 15:23171417-23171439 CAGCAGCCCATGCCTTCGCCTGG - Intergenic
1124284871 15:28392725-28392747 CAGCAGCCCATGCCTTCGCCTGG - Intergenic
1124297826 15:28518889-28518911 CAGCAGCCCATGCCTTCGCCTGG + Intergenic
1128326984 15:66730094-66730116 CCGCACACCATGCATCAGCGGGG - Intronic
1129995845 15:80004309-80004331 CAGCAGACCCAGCACATGCCAGG - Intergenic
1130282349 15:82530260-82530282 CAGCAGCCCATGCCCTTGCCTGG - Intergenic
1130706794 15:86240635-86240657 CAGAAGACCATGCAACTGGGGGG - Intronic
1132994361 16:2815336-2815358 CTGCAGCCCATGCAGCAGCCAGG + Intergenic
1133566924 16:7004701-7004723 CAGCTCACCATACATCTTCCTGG - Intronic
1135680027 16:24448409-24448431 ATGAAGACCATGCATATGCCAGG - Intergenic
1140334815 16:74095404-74095426 CACCAGACATTGAATCTGCCAGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1142791784 17:2272336-2272358 CCCCAAACCATGCCTCTGCCAGG + Intronic
1143276417 17:5714691-5714713 CAGCAGACAACCCATCTGCTGGG - Intergenic
1144036348 17:11369544-11369566 TAACACACCATGCATCTGCAGGG + Intronic
1145259340 17:21345386-21345408 CCCCAGACCATGCTTCTGCAGGG - Intergenic
1149381977 17:56103602-56103624 CAGCAGATCCTACATCTGCTGGG - Intergenic
1150601495 17:66654752-66654774 CCGCAGACCCTGCATTTTCCAGG + Intronic
1151389381 17:73775657-73775679 CAGCAGACCTGGCAAATGCCTGG + Intergenic
1152636387 17:81432257-81432279 CAGGAGACGGTGCACCTGCCGGG - Intronic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1159995096 18:74956720-74956742 CAGCAGCCCATCCTTCTCCCAGG - Intronic
1161144322 19:2668511-2668533 CAGCAGCCCCTCCATCTCCCTGG - Intronic
1161798415 19:6401283-6401305 CATGAGACCCTGCACCTGCCTGG + Intergenic
1163321235 19:16576234-16576256 CACCAGCACATGCAGCTGCCTGG + Exonic
1164157054 19:22603305-22603327 CAGCAGATCATGCAGCTGTTTGG + Intergenic
1164435651 19:28226812-28226834 AAGCAGACCATTCATCTACTGGG - Intergenic
1165065105 19:33224296-33224318 CAGCAGACCGTCCATCAGGCAGG + Intronic
1167201148 19:48066428-48066450 CACCATGCCATGCAGCTGCCGGG - Intronic
1168001122 19:53446908-53446930 CACCAGACCCAGCATCTGCATGG + Intronic
1168367065 19:55797346-55797368 CAGCAAACCATGCAGCTATCTGG - Intronic
925309300 2:2870960-2870982 CAGAAGACCATTCACCAGCCAGG + Intergenic
925379452 2:3415065-3415087 CAGCAGACCCTCTATCTGCCGGG - Intronic
926901141 2:17753517-17753539 CAGCTGACCCTGCCTCTCCCGGG + Intronic
928442277 2:31302496-31302518 AGGCAGACCATGCATCTGTAAGG - Intergenic
929762791 2:44820077-44820099 CAGAAGACAATGCAACAGCCAGG + Intergenic
940703505 2:157075546-157075568 AAGCAGACAATGCACCTGTCCGG - Intergenic
941788591 2:169525455-169525477 CAGAAGAAGATGCACCTGCCTGG - Intronic
943799552 2:192041197-192041219 CTGCAAACCATATATCTGCCAGG + Intronic
947394416 2:229673061-229673083 CAGGAAAGCCTGCATCTGCCAGG + Intronic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
1169265481 20:4164813-4164835 CAGCAGACCAGGCCACTGGCAGG - Intronic
1171099986 20:22373914-22373936 CAGCAGAGCTTGCAGCTGCTGGG + Intergenic
1173060429 20:39655133-39655155 CAGGGGACCAAGCATATGCCAGG + Intergenic
1175565990 20:59977293-59977315 CTGCAGAACAGGCCTCTGCCTGG + Intronic
1175778608 20:61668353-61668375 CCGCAGAGGATGCACCTGCCTGG + Intronic
1175960707 20:62634925-62634947 CACCACACCAGGCATCTCCCAGG - Intergenic
1176090070 20:63314782-63314804 CCGCACACCAGGCATCTCCCTGG + Intronic
1176090087 20:63314834-63314856 CCGCACACCAGGCATCTCCCTGG + Intronic
1176090103 20:63314886-63314908 CCGCACACCAGGCATCTCCCTGG + Intronic
1176090133 20:63314989-63315011 CCGCACACCAGGCATCTCCCTGG + Intronic
1176553407 21:8241301-8241323 CAGCACACCAGGCCTCTGGCTGG + Intergenic
1176572329 21:8424325-8424347 CAGCACACCAGGCCTCTGGCTGG + Intergenic
1176580238 21:8468885-8468907 CAGCACACCAGGCCTCTGGCTGG + Intergenic
1176931412 21:14815270-14815292 CAACAGACCAGGTATCTTCCAGG - Intergenic
1178417118 21:32412845-32412867 CAGCGCACGATGCTTCTGCCGGG + Exonic
1181665341 22:24391661-24391683 CAACAGACCATGCCTCCGCCAGG - Intronic
1182104818 22:27681797-27681819 CTGCAGCCCCTGCATCTCCCAGG - Intergenic
1183831544 22:40420772-40420794 CACCAGACCTGGCACCTGCCTGG + Intronic
1184253960 22:43276603-43276625 CTGCCAACCAGGCATCTGCCCGG + Intronic
1184415586 22:44350173-44350195 CAGCAGCCCAGCCAGCTGCCCGG + Intergenic
1184541416 22:45128089-45128111 CAGCAGACCATAAAGCTGCGGGG - Intergenic
1184756183 22:46517169-46517191 CTGCAGAGCATGGAGCTGCCAGG + Intronic
1185153959 22:49182273-49182295 ACGCAGGCCATGCATCTGCCAGG + Intergenic
1185303609 22:50099308-50099330 CACCAGACCCGGAATCTGCCAGG + Intronic
1185323107 22:50210890-50210912 CTGGAGACCATGCATCTGACCGG + Exonic
1185373614 22:50471941-50471963 CAGCTGAGTGTGCATCTGCCTGG - Intronic
1203258405 22_KI270733v1_random:158329-158351 CAGCACACCAGGCCTCTGGCTGG + Intergenic
950425559 3:12923163-12923185 CACCACACCAGGCATCTGCAGGG - Intronic
950572696 3:13811797-13811819 CTGCAGTCCCTGCACCTGCCTGG - Intergenic
951371805 3:21858601-21858623 CAGGAGACACTGCATCTGCTGGG + Intronic
953089467 3:39709458-39709480 CAGCAGAATCTGCATCTGGCAGG + Intergenic
957136818 3:76298911-76298933 CCTCTGACCATGCCTCTGCCAGG + Intronic
966209911 3:177442674-177442696 CAGCAGACCTCTCATCTTCCTGG + Intergenic
969318484 4:6396090-6396112 CAGCATGCCACGCACCTGCCAGG - Intronic
970265077 4:14273581-14273603 CAGCAGAGCATGCTTCAGCGAGG + Intergenic
974859588 4:67503317-67503339 CAGCAAACCGTGCAGCTGTCTGG - Intronic
979767163 4:124475697-124475719 CTGCACACAATGCTTCTGCCAGG + Intergenic
981324801 4:143433570-143433592 TAGCAGAGGATGAATCTGCCTGG - Exonic
981447667 4:144858867-144858889 CTGCAGAACATGCAGCTTCCTGG - Intergenic
983267492 4:165522748-165522770 CTGCAGACACTGAATCTGCCAGG + Intergenic
985219673 4:187690871-187690893 AAGCAAACCTTGCTTCTGCCAGG - Intergenic
985589585 5:757658-757680 CCGCACACCCTGCATCTTCCAGG + Intronic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
995485510 5:112636355-112636377 CAGCTCACCATGAACCTGCCAGG + Intergenic
996535016 5:124568688-124568710 CAGCAGCCCCTTCCTCTGCCTGG + Intergenic
998811522 5:145971339-145971361 AACCAGAACAGGCATCTGCCAGG - Intronic
999310123 5:150546528-150546550 CAGCAGACCAGGCCTGTGCTTGG + Intronic
1001137425 5:169114268-169114290 TAGCAGAGCCTCCATCTGCCTGG + Intronic
1003521491 6:6862354-6862376 CAGGAGACCAGGCAGCAGCCTGG + Intergenic
1006093574 6:31642321-31642343 CAGCAGACCATGCCCCCACCAGG - Exonic
1006401264 6:33819013-33819035 CAGCAGACCATATTTCTACCTGG - Intergenic
1006698104 6:35948967-35948989 CAGCAGACACTGAAACTGCCAGG + Intronic
1006713790 6:36100202-36100224 CAGCAGATTATGCGTCTGACAGG + Exonic
1008753865 6:54770265-54770287 TAGTAGACCATGCTTCTCCCTGG - Intergenic
1010672998 6:78709036-78709058 CATCAGACACTGAATCTGCCAGG - Intergenic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1017156372 6:151325786-151325808 CAGGAGACTAGGCGTCTGCCGGG + Intronic
1019186756 6:170224941-170224963 CAGCCTGCCATGCGTCTGCCCGG - Intergenic
1019312421 7:369301-369323 CACAAGACCAGGCATGTGCCGGG - Intergenic
1019445432 7:1068584-1068606 CAGAAGACCAGGCCCCTGCCTGG + Intronic
1022948995 7:35317551-35317573 CTGCATACCATCCATGTGCCAGG + Intergenic
1023482883 7:40653645-40653667 CAGCTGACCAGGCAGCTCCCAGG - Intronic
1027915422 7:84312312-84312334 CAGCAGACTCTACATCAGCCTGG + Intronic
1030618966 7:111769054-111769076 CACCAGACACTGTATCTGCCAGG + Intronic
1032085207 7:128880151-128880173 CAGAAAACCAAGCATCTCCCAGG + Intronic
1033955946 7:146848667-146848689 CAGCAGAAGATTCATCTGCTTGG - Intronic
1035223178 7:157418800-157418822 CTGCTGGCCATGCACCTGCCGGG - Intergenic
1035275714 7:157746761-157746783 CAGCAGACCAGGCAGCTGAACGG - Intronic
1035643791 8:1203007-1203029 CACCACCCCATCCATCTGCCGGG + Intergenic
1037552439 8:19987837-19987859 TAACAGATAATGCATCTGCCTGG + Intergenic
1039528550 8:38238103-38238125 CATCAGACCCTGCAACTGGCTGG - Exonic
1039774242 8:40719935-40719957 CAGCAGCCCATGCTTCTCCAAGG + Intronic
1040605554 8:48927868-48927890 CACCAGACTCTGAATCTGCCCGG + Intergenic
1042810143 8:72816299-72816321 CAGCTGCCAATGCATCAGCCAGG + Intronic
1043630130 8:82320832-82320854 CTGCAGACAATGCATCTATCTGG + Intergenic
1045099993 8:98834581-98834603 CACCAGACACTGAATCTGCCAGG - Intronic
1047510334 8:125511031-125511053 CAGCAAACCTTCCATCTTCCTGG + Intergenic
1048333341 8:133485861-133485883 CAGCAGCCCATGTAACTTCCTGG - Intronic
1050877176 9:10653001-10653023 CAGCAGAACATTTATATGCCAGG + Intergenic
1053526748 9:38837821-38837843 CATCAGGCCATGCCTCTGCTTGG + Intergenic
1054198976 9:62062250-62062272 CATCAGGCCATGCCTCTGCTTGG + Intergenic
1054639378 9:67526107-67526129 CATCAGGCCATGCCTCTGCTTGG - Intergenic
1056755856 9:89381690-89381712 CAGCAGAGGATGCATGAGCCTGG + Intronic
1057902089 9:98957336-98957358 CAGCAGACCATGGTTCTTTCTGG - Intronic
1060668590 9:125448554-125448576 CAGCCCACCAGGCATCTCCCTGG + Intronic
1060781119 9:126413958-126413980 CAGCAGGCACTGCAGCTGCCTGG + Intronic
1061120834 9:128641312-128641334 CATCAGACCATGTGTCTGCCAGG - Intronic
1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG + Intronic
1061475504 9:130863090-130863112 CATTAGGCGATGCATCTGCCTGG + Intronic
1062151157 9:135019757-135019779 CAGCAGAAACTGCAGCTGCCAGG + Intergenic
1062333647 9:136055482-136055504 CCTCAGACCATGGAGCTGCCTGG - Intronic
1062438422 9:136557311-136557333 CAGCAGGCTATGCCCCTGCCTGG - Intergenic
1062527598 9:136984602-136984624 CAGCAGTCCATGCAGCCTCCAGG - Intronic
1203474599 Un_GL000220v1:140345-140367 CAGCACACCAGGCCTCTGGCTGG + Intergenic
1203364307 Un_KI270442v1:243728-243750 GAGCAGACCTGGCACCTGCCCGG - Intergenic
1186081591 X:5939134-5939156 CAGCAGACATTCCATCTGCATGG + Intronic
1186724564 X:12343380-12343402 CAGCAGGCCATCCATCTGGCTGG + Intronic
1188115413 X:26237550-26237572 TAGCAGACCCTTCATCAGCCTGG + Intergenic
1190631090 X:52387174-52387196 CAGAAGCCCCTGCAGCTGCCTGG + Intergenic
1190649954 X:52559252-52559274 CAGGAGCCCCTGCAGCTGCCTGG - Intergenic
1190989647 X:55533422-55533444 TAGCAAACTATGCATCTGACAGG - Intergenic
1192258516 X:69487485-69487507 TTGCAAACCATGCATCTGGCAGG - Intergenic
1192542801 X:71989512-71989534 GACCAGACCATGCATCTGGTAGG + Intergenic
1199397502 X:147356709-147356731 CTGCAAACTATGCATCTGACTGG + Intergenic