ID: 1014831936

View in Genome Browser
Species Human (GRCh38)
Location 6:126112996-126113018
Sequence CTGTCCACTCAGATGCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014831936_1014831940 5 Left 1014831936 6:126112996-126113018 CCTTTTTGCATCTGAGTGGACAG No data
Right 1014831940 6:126113024-126113046 AGATGACACTGGAGACATAGAGG No data
1014831936_1014831942 29 Left 1014831936 6:126112996-126113018 CCTTTTTGCATCTGAGTGGACAG No data
Right 1014831942 6:126113048-126113070 GAACTCCCTCCCTGGCCTTCAGG No data
1014831936_1014831938 -6 Left 1014831936 6:126112996-126113018 CCTTTTTGCATCTGAGTGGACAG No data
Right 1014831938 6:126113013-126113035 GGACAGGTCCTAGATGACACTGG No data
1014831936_1014831941 21 Left 1014831936 6:126112996-126113018 CCTTTTTGCATCTGAGTGGACAG No data
Right 1014831941 6:126113040-126113062 ATAGAGGTGAACTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014831936 Original CRISPR CTGTCCACTCAGATGCAAAA AGG (reversed) Intergenic
No off target data available for this crispr