ID: 1014832294

View in Genome Browser
Species Human (GRCh38)
Location 6:126117022-126117044
Sequence CTAGGCTACCAGTTGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014832294_1014832301 12 Left 1014832294 6:126117022-126117044 CCCAGGATCAACTGGTAGCCTAG No data
Right 1014832301 6:126117057-126117079 GGTCCACGATTCAAATTGGTGGG No data
1014832294_1014832299 8 Left 1014832294 6:126117022-126117044 CCCAGGATCAACTGGTAGCCTAG No data
Right 1014832299 6:126117053-126117075 CTATGGTCCACGATTCAAATTGG No data
1014832294_1014832300 11 Left 1014832294 6:126117022-126117044 CCCAGGATCAACTGGTAGCCTAG No data
Right 1014832300 6:126117056-126117078 TGGTCCACGATTCAAATTGGTGG No data
1014832294_1014832297 -9 Left 1014832294 6:126117022-126117044 CCCAGGATCAACTGGTAGCCTAG No data
Right 1014832297 6:126117036-126117058 GTAGCCTAGGAGTTTGACTATGG No data
1014832294_1014832303 29 Left 1014832294 6:126117022-126117044 CCCAGGATCAACTGGTAGCCTAG No data
Right 1014832303 6:126117074-126117096 GGTGGGCCAAACAATAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014832294 Original CRISPR CTAGGCTACCAGTTGATCCT GGG (reversed) Intergenic
No off target data available for this crispr