ID: 1014833386

View in Genome Browser
Species Human (GRCh38)
Location 6:126128878-126128900
Sequence GAAAAGAAAATGCACCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014833384_1014833386 9 Left 1014833384 6:126128846-126128868 CCTGATTACTCTGAACACGTAGG No data
Right 1014833386 6:126128878-126128900 GAAAAGAAAATGCACCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014833386 Original CRISPR GAAAAGAAAATGCACCTAAA AGG Intergenic
No off target data available for this crispr