ID: 1014835727

View in Genome Browser
Species Human (GRCh38)
Location 6:126158356-126158378
Sequence CAGAAAATACAAAAGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014835727_1014835729 -8 Left 1014835727 6:126158356-126158378 CCTTTGTCCTTTTGTATTTTCTG No data
Right 1014835729 6:126158371-126158393 ATTTTCTGCAAATTAGCAGCTGG No data
1014835727_1014835730 5 Left 1014835727 6:126158356-126158378 CCTTTGTCCTTTTGTATTTTCTG No data
Right 1014835730 6:126158384-126158406 TAGCAGCTGGATCCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014835727 Original CRISPR CAGAAAATACAAAAGGACAA AGG (reversed) Intergenic
No off target data available for this crispr