ID: 1014835729

View in Genome Browser
Species Human (GRCh38)
Location 6:126158371-126158393
Sequence ATTTTCTGCAAATTAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014835727_1014835729 -8 Left 1014835727 6:126158356-126158378 CCTTTGTCCTTTTGTATTTTCTG No data
Right 1014835729 6:126158371-126158393 ATTTTCTGCAAATTAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014835729 Original CRISPR ATTTTCTGCAAATTAGCAGC TGG Intergenic
No off target data available for this crispr