ID: 1014835730

View in Genome Browser
Species Human (GRCh38)
Location 6:126158384-126158406
Sequence TAGCAGCTGGATCCAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014835728_1014835730 -2 Left 1014835728 6:126158363-126158385 CCTTTTGTATTTTCTGCAAATTA No data
Right 1014835730 6:126158384-126158406 TAGCAGCTGGATCCAGACACTGG No data
1014835727_1014835730 5 Left 1014835727 6:126158356-126158378 CCTTTGTCCTTTTGTATTTTCTG No data
Right 1014835730 6:126158384-126158406 TAGCAGCTGGATCCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014835730 Original CRISPR TAGCAGCTGGATCCAGACAC TGG Intergenic
No off target data available for this crispr