ID: 1014837318

View in Genome Browser
Species Human (GRCh38)
Location 6:126174109-126174131
Sequence TGAGAGGCTGCAGAAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837318_1014837329 21 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837329 6:126174153-126174175 TCATAGGCTATCCTCAGGAATGG No data
1014837318_1014837331 30 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837331 6:126174162-126174184 ATCCTCAGGAATGGCATTGGTGG No data
1014837318_1014837327 16 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837318_1014837324 5 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data
1014837318_1014837330 27 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837318 Original CRISPR TGAGAGGCTGCAGAAAGGTG AGG (reversed) Intergenic