ID: 1014837319

View in Genome Browser
Species Human (GRCh38)
Location 6:126174114-126174136
Sequence GGGAGTGAGAGGCTGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837319_1014837327 11 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837319_1014837329 16 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837329 6:126174153-126174175 TCATAGGCTATCCTCAGGAATGG No data
1014837319_1014837330 22 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837319_1014837331 25 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837331 6:126174162-126174184 ATCCTCAGGAATGGCATTGGTGG No data
1014837319_1014837324 0 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837319 Original CRISPR GGGAGTGAGAGGCTGCAGAA AGG (reversed) Intergenic