ID: 1014837320

View in Genome Browser
Species Human (GRCh38)
Location 6:126174125-126174147
Sequence GGGCGACAGTGGGGAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837320_1014837334 28 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837334 6:126174176-126174198 CATTGGTGGAGTGTTGGTGAAGG No data
1014837320_1014837327 0 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837320_1014837331 14 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837331 6:126174162-126174184 ATCCTCAGGAATGGCATTGGTGG No data
1014837320_1014837333 22 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837320_1014837330 11 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837320_1014837329 5 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837329 6:126174153-126174175 TCATAGGCTATCCTCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837320 Original CRISPR GGGCGACAGTGGGGAGTGAG AGG (reversed) Intergenic