ID: 1014837323

View in Genome Browser
Species Human (GRCh38)
Location 6:126174136-126174158
Sequence CTATGAGGAGTGGGCGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837323_1014837329 -6 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837329 6:126174153-126174175 TCATAGGCTATCCTCAGGAATGG No data
1014837323_1014837330 0 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837323_1014837331 3 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837331 6:126174162-126174184 ATCCTCAGGAATGGCATTGGTGG No data
1014837323_1014837333 11 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837323_1014837334 17 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837334 6:126174176-126174198 CATTGGTGGAGTGTTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837323 Original CRISPR CTATGAGGAGTGGGCGACAG TGG (reversed) Intergenic
No off target data available for this crispr