ID: 1014837324

View in Genome Browser
Species Human (GRCh38)
Location 6:126174137-126174159
Sequence CACTGTCGCCCACTCCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837319_1014837324 0 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data
1014837316_1014837324 26 Left 1014837316 6:126174088-126174110 CCTTGGCAACACATGTTCCTTCC No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data
1014837317_1014837324 9 Left 1014837317 6:126174105-126174127 CCTTCCTCACCTTTCTGCAGCCT No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data
1014837318_1014837324 5 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837324 6:126174137-126174159 CACTGTCGCCCACTCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837324 Original CRISPR CACTGTCGCCCACTCCTCAT AGG Intergenic
No off target data available for this crispr