ID: 1014837327

View in Genome Browser
Species Human (GRCh38)
Location 6:126174148-126174170
Sequence ACTCCTCATAGGCTATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837318_1014837327 16 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837321_1014837327 -9 Left 1014837321 6:126174134-126174156 CCCCACTGTCGCCCACTCCTCAT No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837322_1014837327 -10 Left 1014837322 6:126174135-126174157 CCCACTGTCGCCCACTCCTCATA No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837320_1014837327 0 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837317_1014837327 20 Left 1014837317 6:126174105-126174127 CCTTCCTCACCTTTCTGCAGCCT No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data
1014837319_1014837327 11 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837327 6:126174148-126174170 ACTCCTCATAGGCTATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837327 Original CRISPR ACTCCTCATAGGCTATCCTC AGG Intergenic
No off target data available for this crispr